The Big Tree

Alex Williamson

Last Updated October 25, 2014


This is a draft phylogenetic tree for the R-L21 Y-DNA haplogroup. The data for this tree comes from Big Y tests taken at Family Tree DNA, as well as sequencing completed by FullGenomes Corp. As the data continues to be analyzed, changes will be made. A summary of changes made to the tree can be found here.

If you have R-L21 Big Y or FGC results, and they don't appear in the tree below, please e-mail me the results and I'll include them. Conversely, if your results do appear below and you don't want them to, e-mail me and I'll remove them. Better yet, you should upload your raw data to the R-L21 Yahoo Group so that they'll be available to other researchers. It's free to join the group, and it's a great forum to get involved in R-L21 research.

For the most part, the structure of the diagram reflects the Big Y and FGC data. However, it was often necessary to make assumptions that should be checked by examination of the BAM file or, if still inconclusive, by direct testing. Mutations that are shared between multiple clades, and INDELs which appear to be nothing more than STRs have not been included.

The boxes in the diagram below are arranged in a tree structure. L21 is at the top of the tree. Within each box, each row corresponds to a physically different, but phylogenetically equivalent mutation. In fact, I mean phylogenetically equivalent as far as this data is concerned, ISOGG may actually split them. If no names for a mutation are known, then it's position as well as reference and alternate values are given in the form, "POSITION-REF-ALT".

Those mutations written in a lighter color with a question marker after them have not been tested by the individual, and so could potentially be positive. Generally, they were found to be positive in other parallel men.

If you hover over the name of a SNP in the diagram below, a tooltip will indicate the location, ref and alt values. There is also a no names version of this tree, if you wish to search also mutations by their position.

On August 23, 2014 I began to introduce provisional mutations (background colour is red) into the tree. Some of these mutations have ZZ series names. These mutations are generally marked as REJECTED in the FTDNA .vcf files, and have multiple variants. They are typically from regions of the Y for which similar regions exist. The most important property of the mutations I'm introducing is that they are phylogenetically consistent. They don't occur in any other men, and they demonstrate a sensible relationship to the other known mutations.

R-DF63
Irish Type II
Little Scottish Cluster21-5909-LS
County Galway
Clan Colla/Airgíalla Type I21-n922-A
Ely Carroll
R-DF41
R-M222
Scots Cluster
Wales 2
Irish Type III
Irish Continental/Irish Type IV
Irish Sea
37201
Berry
290662
Wildes
54798
Franklin
174870
Franklin
81528
Franklin
B2414
Faust
13335
Franklin
N76446
McFarlin
230321
MacFarlane
273077
MacFarlane
206124
Black
N51736
Black
109264
Black
N66966
Gery
H1922
Schaefer
232541
Roma
208171
Allan
N11946
Broom
12311
Broom
229499
Bertrand
298668
Bertrand
260685
McDonagh
N40156
Green
9875
Daniel
115893
Blandford
35874
James
185703
Pruett
143584
Middleton
116159
Kenyon
173877
Collins
43205
McLaren
17642
McLaren
264781
Maynord
248752
Maynard
286072
Maynard
270745
Maynard
259801
Maynard
65932
Wigand
96153
McDonnell
0FW1R
Jost
H1890
Fitzpatrick
198135
Brunet
N55408
Smith
268203
Leman
288079
Maxwell
276351
Maxwell
320449
Maxwell
3204
Maxwell
231244
Hinman
166617
Wiegand
N82444
Case
83115
Whelan
141799
Redden
275223
Posey
N94507
Beare
202776
McCartney
294056
Dyers
169169
Edwards
202133
Mulcahy
169042
Barrus
165440
Mahoney
115485
O'Mahony
257151
O'Reilly
N27645
Fowler-Finn
273871
Howie
328050
Coldwell
181672
Corder
256982
Foley
N59178
Carroll
298545
Lee
163061
Davies
11211
O'Donoghue
154255
Sullivan
254559
Anderson
179653
Sullivan
295125
Keith
352
Glennon
128753
Griffin
N45540
Peel
229625
Murray
284952
Crowley
251695
Cremeen
75606
Irwin
188279
McDonald
37571
McDonald
B5288
Burns
128856
McCarthy
107457
McCarthy
117962
Ragan
73128
Riggin
275522
McAuliffe
189728
Robertson
H1944
Romstad
N117672
Johnsen
290447
Brown
25836
Davidson
310554
Brazil
10505
Simmons
267249
Butler
130070
McBee
21418
McRaney
169548
Warthen
237868
Collins
264685
MacDonald
E13942
LeFevre
KAQZG
Edgecombe
176268
Gontaut
10119
McCarthy
222616
McCarthy
N28007
Porter
207157
Leahy
169021
Kennedy
50242
Lawrence
133832
Reddin
B6603
Kidd
N16254
Canady
163654
Killgore
155957
Hall
213751
Miller
196041
Williamson
263928
McCorkle
19822
Wilson
237552
Doggart
N11153
Corcoran
209130
Rowan
DQWHW
Fueston
B1510
Yabsley
51784
Humphrey
288211
Nichols
BAPCG
Cain
169902
Kain
SAXZC
Reynolds
N20114
Coberly
21340
Grant
108223
Grant
282333
Owens
42087
Viar
157289
Viar
282328
Morrison
102866
Morrison
26384
Morrison
122847
Moore
45131
Doolin
205429
Kelley
212914
Phelan
112244
Harbour
N41845
Carroll
61096
Hendricksson
36836
Paden
259601
Johnson
180119
Lawler
8551
Roderick
N57121
Compton
96415
Higgins
B2743
McMahon
264834
Courtney
31491
Carroll
37416
Kern
82960
McQuillan
68859
Edwards
278275
McDaniel
222108
McGuire
32277
McGuire
127469
Biggins
113649
Beeman
328342
Østerud
263699
Connally
166797
Hart
182999
Hart
N69302
White
209736
Collins
319027
McGuire
45013
Tracey
23133
Linville
48750
Crow
194206
Murphy
6781
Rose
146114
Bowe
253508
Green
256210
Corcoran
105059
Swann
53766
Farris
140820
McClellan
155347
Hamilton
N27653
Cupit
44592
Helm
91126
Doyle
70983
Williams
11R9D
Maher
292794
Cunningham
158136
Montgomery
316273
Oliver
240201
Walker
29FKD
Walker
32434
Morrison
82890
Morrison
52062
Miller
170555
McBurney
21647
McCleland
29705
McCown
B9S75
McCown
22849
McCown
256811
Wilson
116493
Matthews
N76583
Ryley
U2676
Robinson
239315
Thompson
35963
Pearce
147822
Stuart
330477
Stewart
283694
Stewart
75703
Webb
5987
Clancey
164047
Stewart
315522
Stuart
E16164
Stuart
128499
Stewart
187778
Stewart
256138
Ward
284562
Black
176148
Duffy
31023
Lamberson
348926
Lamberson
223212
Louw
N104746
Samuel
53479
Selfe
17609
Conn
47694
MacMillan
252939
Dixon
35212
McCrere
B1871
Lally
181933
Lally
53095
Dowell
205297
McConnaughhay
329024
Brennan
N26284
Leister
320253
Daugherty
56598
Dunbar
N104491
McCollum
214610
Haggerty
135550
Milligan
169185
Milliken
12068
Millikin
98188
Hamilton
30771
Burns
205549
Dunbar
43598
Lane
215509
Ewing
78346
Wilson
23702
Milliken
7213
McKenny
12701
Ferguson
229652
Williams
88905
Degnen
56154
Howle
230303
Braswell
36712
O'Shaughnessy
146333
Riley
47582
Leonard
167335
MacDaibheid
196477
Morrison
343491
Mullins
B3060
Whelan (Early)
WHU9V
Conroy
94854
Gillespie
S4C39
Wilson
178883
Sheridan
27202
Cunniff
164044
Dexter
12305
Freeman
300324
Courtney
N108400
Joyce
B2944
Thomas
MRD4P
Trainor
255112
Sullivan
262468
Johnston
137235
Caldwell
108697
Vaughn
59601
Wilson
117897
Stedman
204936
Smith
255954
Blair
230866
Officer
256925
Bengtsson
B3231
Allison
33932
Hopkins
205239
Culver
96841
Reynolds
122950
Pruett
256386
Pruitt
237862
Pruitt
63127
Templeton
270944
Unknown
143812
MacRae Halligan
241056
MacRae
203147
MacRae
12816
McDonald
12836
McDonald
21165
Jamieson
90181
McPherson
57711
MacDonald
100137
McCoy
B1955
McCoy
95886
McCoy
160609
MacDonald
167382
MacDonald
208355
Bissett
221193
McDaniel
84796
Hosie
230483
Lindsey
161189
Bain
6MVR8
Taylor
147012
Young
156568
Ro(d)gers
153130
Moore
238132
Kiler
28273
Bolton
N51005
MacPherson
159792
McPherson
117764
McKinnon
14346
Tagert
36198
Alexander
43454
Alexander
89325
Alexander
89324
Alexander
227541
Unknown
233722
Alexander
191228
McGregor
190435
Stewart
182121
Ferguson
260814
Looper
285203
Cameron
14555
MackMillion
48641
MacMillan
H1003
McCoy
74757
McDowell
B1047
Bennett
108937
Neilson
10348
Lee
7DCXW
Iles
284138
Gillespie
N44383
Tate
N5620
Erickson
19706
Price
228773
Price
N84982
Turner
9139
Kennedy
279185
Kennedy
279183
Little
144090
Little
174934
Beatty
45742
Little
13273
Little
192941
McVittie
49038
Glandenning
190210
McDonald
268319
Knox
159822
Meek
279772
Black
231779
Davidson
46951
Ferguson
154439
Proffitt
29753
Sinkler
110067
Sinclair
50994
MacPherson
83015
McConnell
H1601
Fitzpatrick
197401
Carey
251996
McLoughlin
271595
Guild
65521
Robertson
37986
Cameron
260538
Mackenzie
39431
MacKenzie
215816
Williams
43722
Connell
61721
Plunkett
226869
McGuire
N2051
McGuire
31293
McCown
139578
Clarke
228829
Bruen
N86695
Byrne
56563
Byrne
132342
Pillsbury
95100
Hayes
N28178
Hays
250219
Merrick
8633
Thomas
4479
Devine
N112468
Diver
234631
Matthews
131998
Fritts
286080
Roddy
224032
Nicholson
230107
Nicholson
211516
Connor
175552
Moody
N57202
Healy
204537
Coleman
276580
Martini
188436
Noe
264348
Collins
106714
Kingston
21834
White
52669
Winters
56277
Winter
117944
Wilson
N29541
Sunesson
238987
Welsh
N54638
Walsh
58568
Barrett
7WDDR
Reid
56954
Vance
228009
Kane
32119
Rose
210379
Roberts
170191
Bond
311690
Turner
N114163
Walter
23361
Gregory
B3500
Bean
54142
Bayne
271376
Norton
E5945
Secher
105425
Parry
26059
Durall
284128
Mather
235406
LeDuc
293753
Blais
N113834
Ingram
36483
McDaniel
26082
Dowell
26215
Dowell
167501
Murphy
267584
Murphy
N12172
OConnor
190229
Wahab
N8772
Porter
30949
Raburn
316659
Henry
191679
Britton
188927
Hammond
311268
Cunningham
65048
Erwin
22874
Irvine
N117305
Donatella
N126307
Withers
20156
Breen
N98521
Desmond
231656
Burgin
24273
Norman
255219
McDonald
187172
Lewis
196158
Rickwood
116944
Churchman
327025
Brock
ZLHF1
Yurzditsky
201644
Burde
109174
Harrington
180639
Crawford
220731
Bell
188401
Hopkins
N10900
Pierce
N44578
Roberts
79421
Richards
264132
Davis
N112316
Dorr
171804
Sanchez
0ANEE
Godwin
189806
Castle
204709
Whidden
251710
Murphy
227117
McNeilage
253986
Heikki
95316
MacConnell
144395
Cameron
N49035
Muny
3026
Beatty
91CZO
Casey
48596
O'Brien
29355
O'Brien
N54074
Dunn
293008
McMahon
16274
Anderson
N97658
Riel
N54074
Cannon
25505
Wright
260936
Martin
241991
Clancy
244911
McCabe
132694
Musgraves
237481
O'Shea
43543
Williams
B2394
Goff
289541
Fitzpatrick
27770
O'Shea
141217
Coker
79763
Fletcher
298547
Donaldson
275343
Bridgnel
N16295
Ramsey
B3820
Murray
264622
Hockings
N112169
Downing
40717
MacKenzie
280514
McKenzie
81795
Whitehead
233265
LeGall
58625
Saldana
115596
McIan
106724
Godfrey
212724
Yorke
134798
Roderick
49737
Christie
205635
Murta
B4794
Tompkins
6874
Parham Mangum
6879
Mangum
8621
Mangham
N26398
Canady
N85391
Morgan
94662
Mitchell
99512
McClure
149770
Stabley
284099
Hill
172277
Pry
329685
Taylor
23996
Pike
10999
Sothwell
257069
Robertson
255297
Ward
200481
Buchanan
174932
Anderson
219896
Heffernan
71421
Carrucan
29145
Cursonwhit
169385
Moore
229805
Vennemore
86086
Kiely
90790
Coyle
35733
Spence
40730
Park
N2871
Burns
196076
Byrne
54354
Byrne
170615
Byrne
325507
Wynne
5074
Byrne
138281
Rennie
326583
Singleton
246890
Byrne
97440
Grant
262052
Knowles
273539
Humphries
N8296
Barry
178431
Berry
69605
Berry
88224
Quilliam
33100
Doty
3032
Beattie
158241
Beatty
13806
Beattie
185218
Murphy
275787
Phillips
10359
O'Shea
315017
Friberg
H1868
Fitzpatrick
N2553
Weymouth
231221
Olsen
252528
Blake
N101540
Gleason
228288
Prendergast
100136
Phelps
46114
Creamer
219493
Miller
L21 S145
L459
S245 Z245
S461 Z290
Z260
2878344-A-T
8624066-C-T
8640108-T-A
8903612-A-G
9171839-C-T
9445643-A-AT
13670328-T-C
13822845-G-T
14071195-T-G
15709021-T-C
16698417-C-T
16713731-G-A
17039527-G-A
17071491-AAAGA-A
17253602-G-C
17347935-GAGA-G
17530112-T-C
18221085-A-T
18616946-C-T
19545195-C-T
20833280-C-T
21728790-A-G
21798748-C-T
22442995-G-C
22487957-G-A
23295728-A-G
M5820
23743393-C-T
23869638-G-T
23873506-G-A
23998633-G-A
24495615-TCAAA-T
6429097-G-GT
6783544-T-C
7052271-G-GC
7515914-AC-A
7921535-G-T
8126071-G-A
8285042-G-A
8629502-C-T
9093163-A-G
13204087-ATAG-A
13649067-T-A
15265787-G-C
15999235-C-T
16626243-C-T
16812963-G-A
18728176-T-C
18751848-G-T
19156498-G-A
19238241-A-G
19430273-T-C
21291084-T-A
21510234-G-A
21567195-G-GA
21648016-A-G
22214317-T-C
22261099-G-C
22261472-G-T
22270711-G-T
22463755-T-C
22477144-G-C
22477151-C-A
22477152-T-G
22477155-T-C
22477166-G-A
22477172-C-G
22477187-A-G
22477201-C-T
22477211-G-A
22477227-G-A
22477249-G-T
22477254-T-G
22477261-A-G
22480266-C-G
22597477-C-T
22670556-C-T
22762498-G-T
23850407-A-C
24521454-A-G
DF63 CTS300 S522
CTS6919 S3689
A91
A93
A94
A95
Z16243
ZZ15
A92
8439096-GT-G
8865439-G-A
9100008-T-A
14006491-A-G
14248524-T-C
14317050-G-C
16194999-C-T
16196993-G-T
16666772-T-G
17064154-A-C
17091834-C-T
17609294-A-G
17705837-T-A
18365719-G-T
19036514-A-G
19381348-A-G
19750814-G-C
21730648-G-T
22444357-C-A
22460109-T-G
22460570-T-C
22463159-C-T
22463164-G-T
22463167-A-T
22463230-T-A
22463232-T-G
22463237-G-A
22463240-T-C
22463242-C-A
22463244-G-A
22463249-T-G
22470294-A-C
22474287-G-A
22519438-C-A
23020455-C-T
23758322-G-A
24523234-A-C
28734090-T-C
22443980-C-G
22462500-C-A
ZZ15
22443980-C-G?
22462500-C-A?
22463159-C-T?
22463164-G-T?
22463167-A-T?
15181199-C-T
15864268-CA-C
16443189-C-A
18716533-C-A
19332304-C-A
22461855-G-T
18816313-A-C
17702704-G-C
22443109-A-C
YFS033285
22461631-G-A
22461633-G-GT
PF1180
22463112-A-G
22463114-T-G
23325320-G-A
22443980-C-G?
22462500-C-A?
22463159-C-T?
22463164-G-T?
22463167-A-T?
2860718-A-AT
7512600-TA-T
22440812-C-A
22817908-C-G
2818466-G-A
Z16506
Z16507
Z16508
Z16509
F1452
Z16510
Z17552
F489
Z16511
Z16512
Z16513
Z16514
Z16515
Z16516
Z16517
Z18140
Z18141
FGC17162
FGC17163
6426188-T-G
9095491-G-A
8030332-A-G
15129623-C-A
15976768-C-T
18176086-G-T
14124870-C-A
16495580-C-T
18044260-GATTTATGGGCA-G
19351202-T-A
21542481-C-T
13671755-G-T
15829160-T-C
15976852-A-T
17513179-G-A
FGC17164
FGC17168
FGC17165
FGC17167
18036305-T-G
19068248-G-T
F4007
PF5820
ZZ15?
2752813-T-C
7785912-T-C
7813284-C-T
8268852-G-A
8328261-T-C
8614894-C-A
9027324-TG-T
9422293-T-C
9880706-G-A
14171935-T-C
14201671-C-A
14280044-C-T
14280594-G-C
14287367-A-C
16750486-A-G
F2256
16798332-T-C
18899860-G-T
19032177-T-C
19208279-G-C
19414262-C-T
19544748-T-G
21405752-T-C
21484344-G-A
22483333-G-T
23161983-AG-A
23459023-G-A
23851713-G-A
ZZ15?
2764407-T-C
6650715-A-G
7727019-C-T
7943236-C-A
8231469-A-G
8248966-G-T
8442917-T-C
8507455-C-T
8577090-A-G
9392718-A-G
13686671-C-A
13714187-G-T
14400377-T-G
15182036-G-A
15916084-A-G
16288097-T-TA
17008978-T-G
17317295-C-T
17384865-A-G
17585627-T-C
17842150-G-A
18221114-A-T
18616205-C-A
18672411-A-G
19110775-A-G
19139731-C-T
19296395-G-C
21294907-C-T
21309519-C-T
22009520-T-C
22580910-C-A
22803821-G-A
24428250-T-A
Z16245
Z16246
CTS5454
Z17553
2800843-G-C
7339413-C-T
7568123-C-A
7983393-AT-A
8082348-G-A
8292375-G-C
9393304-T-C
9777741-G-C
13829710-G-A
13990639-G-A
14006462-G-A
14474030-G-A
15052292-CTTTG-C
15350548-T-G
15362060-T-A
16265198-G-T
16544030-G-GTA
17472115-G-A
17912215-C-A
17963311-A-G
18177610-T-TCACC
19341055-C-G
21141894-C-T
22294326-G-C
22444542-G-C
22565115-A-G
22574344-C-T
22748834-C-G
22889664-CA-C
22907114-TC-T
22910922-C-T
22922760-G-A
23768195-G-T
24381402-AT-A
24430636-T-A
24437689-G-A
26113186-G-A
27356390-T-C
7328750-T-G
7751633-G-C
8099331-G-C
8467026-G-C
14343135-C-T
15589917-G-C
15811170-T-A
17365399-G-A
17703077-A-C
19125868-A-C
19309865-T-A
20820063-G-A
21452899-C-T
21490909-C-T
22229793-T-G
22269665-A-G
22298158-G-T
22310370-T-C
24481845-G-A
Z17553?
4077973-A-G
7533892-G-A
7657223-C-A
8226824-T-G
8590735-C-T
8655783-A-G
9157274-C-T
9864633-A-G
13136754-G-T
14209458-G-A
14329163-T-G
14343490-C-G
14939957-A-G
15348826-A-T
16390379-G-A
17975003-T-A
18028023-T-A
18935467-A-G
18943186-C-T
19348003-G-T
21142747-G-A
21684201-A-C
21979258-G-A
22470062-T-C
23114857-T-C
23419970-T-C
23549577-T-C
23989012-G-A
6145728-C-G
17409427-C-T
14395398-GA-G
13716871-G-A
13843529-G-A
14955962-C-G
16298114-G-A
16472791-G-A
16715314-C-T
18913204-G-A
19314925-T-A
19367236-A-T
21146176-A-T
21414526-T-C
21590645-T-C
21932474-T-A
22472863-C-T
23160100-C-A
23252211-G-T
23647749-G-A
24464569-T-C
28633264-G-T
28755407-C-G
6677170-G-A
7153603-A-G
7848208-A-T
7849304-C-T
7951308-A-T
8898883-A-G
9087486-A-C
9139010-G-C
9828178-G-A
18934073-T-TA
8029414-A-AT
14298122-G-T?
22263124-A-G?
17284974-G-GT?
18705097-G-GACTT?
25246370-CTCT-C?
18252503-C-T
PR7318
14298122-G-T
22263124-A-G
22524909-A-T
22954430-T-G
7805999-G-A
17284974-G-GT
18705097-G-GACTT
25246370-CTCT-C
CTS241 DF13 S521
CTS8221 Z2542
2686256-CTATG-C
2804221-AGGC-A
7057768-C-T
8011799-C-T
8441865-T-C
8881930-G-A
9031421-T-A
F1493 M6377
9380422-A-AG
9848456-CAT-C
13714655-G-A
13900023-A-C
14248623-A-C
14581865-G-T
15224122-T-G
15228221-G-C
15439808-C-A
15950767-G-A
15967221-T-C
16385627-G-A
16551965-A-C
16877458-C-G
17772993-C-T
17791065-C-T
17866254-TCA-T
17911727-C-A
18123740-G-C
18648688-T-TT
19365275-T-A
21176789-A-T
21187027-CT-C
21223847-C-T
21481619-C-T
21519170-A-G
PR3302
22461085-C-T
23655333-T-A
24493217-C-G
26054314-C-T
6783530-T-C
7151206-T-G
7329622-A-T
7427783-T-C
7676119-C-A
8213289-C-T
9876459-C-G
9983659-G-A
13639720-C-T
14177262-C-G
14210428-C-A
14491903-C-A
14883781-TCA-T
15925099-C-T
17712144-C-T
18019593-G-T
18681237-C-T
19006495-T-C
21071779-G-A
21650380-C-T
21688248-G-A
22293830-TG-T
22459102-T-C
22464620-A-T
22464644-C-G
22480307-A-T
23118113-G-A
23315743-T-G
14229179-A-G?
7144431-C-T
7144486-T-C
7204148-A-G
7580356-C-T
8050129-A-G
8598663-C-A
8642095-G-T
9769539-A-G
M3495
10024696-G-C
14402926-C-T
16248714-C-T
CTS6229
16940391-A-T
17887357-A-G
17926121-AG-A
18060164-A-G
18168161-T-C
18739309-T-C
18760535-A-G
19512910-CAAT-C
21341489-A-G
21444871-A-T
21548590-T-G
22419855-T-G
22470469-G-A
22474277-C-G
22516135-A-T
23367240-G-T
23367241-C-A
23367244-G-A
23510099-T-C
24400715-C-G
28789350-T-A
FGC20084
FGC20085
6360126-T-C
7591215-T-A
FGC20088
FGC20089
FGC20090
FGC19513
Z17183
9095893-TC-T
FGC20091
FGC20092
FGC20094
FGC20095
FGC20096
FGC20097
FGC20098
FGC20099
FGC20100
FGC20101
FGC20102
FGC20103
FGC20104
21903924-TTAATC-T
FGC20105
22485341-T-A
FGC20106
FGC20107
FGC20109
FGC20110
2777444-T-C
6373114-C-A
6958764-T-C
7133064-C-T
7249658-G-A
7811090-A-G
7955053-G-A
8247899-T-C
8655465-T-G
8982048-T-C
9064742-C-T
9349709-T-A
9850309-A-T
13669717-T-C
13683791-T-G
14118114-G-A
14223630-C-A
14821266-C-T
15670599-G-A
16233001-G-A
16372344-T-C
17332432-C-A
17996528-G-A
21469407-T-C
21916161-A-T
22460365-A-G
22469035-T-A
22476220-C-T
23378958-G-A
23431788-T-A
23599156-A-G
23819691-A-G
24453960-G-T
28783967-C-A
CTS3937
FGC13795
FGC13785
FGC13800
FGC13786
FGC13783
Z17965
FGC13788
FGC13780
FGC13793
FGC13787
F3477
FGC13772
FGC13773
FGC13774
FGC13775
FGC13776
FGC13777
FGC13778
FGC13781
FGC13782
FGC13784
FGC13789
FGC13791
FGC13792
FGC13794
FGC7761
FGC13796
FGC13797
FGC13798
FGC13799
FGC13801
FGC13802
FGC13803
CTS1122
2754791-A-T
4875018-C-A
8014086-C-T
8267234-A-G
8488647-C-T
9470059-T-A
9988983-C-G
13649259-G-T
14584135-T-C
14653390-A-G
15181164-C-A
15211960-A-C
15470408-G-T
FGC13790
16802401-T-A
16803937-A-T
16922956-C-T
17867885-G-A
17981076-C-T
19243041-C-T
19334669-C-A
22457745-G-A
22516488-T-C
22549685-A-G
22559286-G-T
23733686-G-A
23895588-C-T
FGC5494
ZZ22
FGC5561
6734258-T-G
6796420-C-T
7147369-T-A
7988964-C-T
8021919-T-G
8126298-TTTTTTATTT-T
8126308-TA-T
8615109-C-T
8667126-A-G
9397230-A-C
9980952-G-A
13852424-C-A
14078141-G-C
14408092-G-A
14435754-C-CG
17772323-C-T
17867477-AGTAAAT-A
18106423-C-G
19308466-T-A
19815721-A-C
21044525-A-C
21151171-G-C
21734686-A-G
21810390-G-T
PF1839
22294217-A-T
22362191-C-A
22993089-A-G
23237032-C-T
23606959-C-T
23813395-A-T
23881468-A-AACAG
24361427-T-C
M954
FGC19914
FGC19915
FGC19916
FGC19917
7889083-GC-G
FGC19918
FGC19919
FGC19921
FGC19922
FGC19923
9101018-C-G
9101020-G-A
FGC19924
FGC19925
13325622-AGACT-A
FGC19926
FGC19927
FGC19928
14407185-T-C
L1314
FGC19929
FGC19930
FGC19931
FGC19932
FGC19933
FGC19934
FGC19935
FGC19936
FGC19937
FGC19938
FGC19939
20020381-C-G
FGC19942
FGC19943
FGC19944
FGC19912
FGC19945
FGC19946
FGC19947
FGC19948
14229179-A-G
14231742-C-A
14462032-G-A
14506337-A-G
15005230-G-A
15226575-T-A
16181585-T-G
16291601-A-G
16671352-T-G
16694944-A-C
17650196-T-C
18908011-C-T
18914601-C-A
19046890-G-A
19068195-G-A
19471860-A-C
20819465-G-A
21292003-C-T
21639093-G-T
22157567-C-G
22256737-G-A
22261148-G-C
22527882-C-A
22549565-G-A
23040110-A-G
23264603-G-A
23508176-A-T
23899590-A-G
24410252-C-T
6899532-C-T
7315917-T-C
7863469-A-G
7872799-C-T
7951307-A-T
8201682-A-T
8241290-G-A
8483309-C-T
8904637-T-G
9164873-G-T
14666656-CC-C
14666660-CT-C
8793202-AT-A
18032195-C-T
21477392-C-A
21565884-G-A
23482909-A-G
24381230-T-A
7013677-C-T
7721178-C-T
21135869-C-CT
S1251
S1252
S1253
S1254
2782591-C-T
L701
7593818-C-A
7888957-A-G
7979072-A-C
8529776-T-C
9790764-A-G
14319324-C-G
14374773-C-A
16240350-A-G
17977439-T-C
18914551-T-A
18932895-C-A
19444613-A-G
19468715-T-C
22026272-ATCTTTT-A
22472616-G-A
23799139-T-C
15458070-C-G
16698463-G-A
18195064-T-C
22484695-T-A
23607692-C-T
7650786-T-C
22462165-C-T
23488858-A-C
7817470-A-AT
7650786-T-C?
7817470-A-AT?
13140211-CATCCT-C
16756059-G-C
PR2673
18195064-T-C?
23488858-A-C?
13139400-C-T
15458070-C-G?
16698463-G-A?
22484695-T-A?
23488858-A-C?
7817470-A-AT?
6779633-G-T
8335028-G-C
21556531-G-A
23607692-C-T?
15424639-GA-G
22462165-C-T?
8546418-G-C
15491978-T-TAC
18395036-T-C
23516210-C-T
FGC5496
FGC7448
S1088
PR1289
A194
14176077-T-C
A162
A163
A192
A164
A165
A166
A193
A167
A168
A169
A170
A171
A172
A173
9469513-G-C
M3668
M3669 S12547
M3670 S12548
M3671
A174
13457294-T-C
A175
A176
A177
A178
A179
A180
A181
A182
A183
A184
A185
17993340-A-G
A186
A187
A188
A189
A190
A191
22478175-T-G
23752173-ACT-A
A194?
2726715-C-G
6465163-T-G
6779668-C-G
7113554-C-T
7244756-A-G
7671438-T-C
8051222-A-G
8449149-C-G
8530829-CTG-C
13647673-C-G
CTS2457 CTS2457
14409606-G-A
17852615-C-T
17891023-C-T
18849606-T-G
19450649-G-A
21062462-C-T
21287660-T-C
21681927-AAG-A
21722689-C-T
21836043-T-C
21986218-C-T
22137660-G-A
22439825-C-G
22445609-G-T
22445610-G-T
22445615-T-G
22445621-G-A
22656185-C-A
23606064-T-C
23883903-T-G
28700245-G-T
FGC5521
FGC5512
FGC5549
FGC5511
FGC5548
FGC5558
FGC7997
FGC5514
FGC5515
FGC5516
FGC5517
FGC5518
FGC5519
FGC5520
FGC5522
FGC5523
FGC5524
FGC5525
FGC5526
FGC5527
FGC5528
FGC5529
FGC5530
FGC5531
FGC5532
FGC5533
FGC5534
FGC5535
FGC5536
FGC5537
FGC5538
FGC5539
FGC5540
FGC5541
FGC5542
FGC5543
FGC5544
FGC5545
FGC5546
FGC5547
FGC5550
FGC5551
FGC5552
FGC5553
FGC5554
FGC7996
FGC5555
FGC5556
FGC5557
FGC5559
FGC5560
FGC5497
Z3872
FGC5498
FGC5499
FGC5500
FGC5495 S7958
FGC5501
FGC5502
FGC5503
FGC5504
FGC5505
FGC5506
FGC5507
FGC5508
FGC5509
FGC5510
FGC5513
6991536-C-T
7812716-G-C
7930669-A-G
8224635-G-C
8445864-G-A
13831827-G-T
13864980-G-T
14032802-G-A
14727714-A-C
15907961-C-T
16606014-G-C
16647414-A-G
16856557-A-T
17081345-A-T
17337385-G-A
19122878-A-G
21205908-G-A
21423342-C-T
21424515-A-G
22271955-T-C
22735874-A-G
23196609-C-G
23196643-A-T
23637853-C-T
24071390-G-A
FGC5549?
A116
6379906-A-G
A117
A118
A119
A120
A121
9016584-T-A
9043923-G-T
A122
A123
A124
13720183-G-A
A127
A128
A129
A130
A131
A132
A133
A134
A135
S2202
A136
A137
A138
A140
A141
22246748-T-C
22423651-G-T
22484354-ATG-A
22513620-TG-T
A142
23751087-C-G
23873080-C-T
24001958-G-A
24001960-G-GC
A144
25073647-C-T
CTS2796
FGC19329
CLD12
FGC19333
FGC19334
FGC19335
FGC19336
FGC19337
FGC19338
FGC19340
FGC19342
13684327-T-A
13684328-A-C
FGC19343
FGC19344
FGC19346
FGC19347
FGC19348
FGC19349
FGC19350
FGC19352
17982608-GATA-G
19452300-AT-A
S23106
FGC19356
FGC19357
FGC19358
FGC19359
22464458-G-C
22475663-C-T
22489150-C-A
22489402-T-G
22519735-T-C
22519747-T-C
M3846
FGC19361
Z16502
Z16503
Z16504
Z16505
Z17634
Z17635
Z17636
Z17637
Z17638
Z17639
Z17640
Z17641
L1444
Z17642
Z17643
Z17644
Z17645
Z17646
Z17647
Z17648
Z17649
Z17650
Z17651
Z17652
Z17653
Z17654
Z17655
Z17656
Z17657
Z17658
Z17659
CTS310?
8791238-G-A
14038349-A-G
15544768-C-T
17920810-C-A
18043669-G-C
21959972-T-A
22478168-T-A
22486623-C-T
23554773-A-G
23554774-A-G
23554777-C-T
23888987-C-T
CTS310
M7884
22272589-C-A
7407748-AC-A
13803546-T-A
15746956-C-A
CTS4727
17530172-G-T
18743506-A-G
22228477-T-A
23161547-T-C
Z17634?
Z17649?
14404314-G-C
15558805-T-C
17895869-A-G
21100421-C-T
7510190-G-A
15524107-T-C
18762655-T-G
22364211-C-A
22458102-T-A
FGC13519
FGC13520
FGC13521
FGC13522
FGC13523
8976513-G-A
FGC13525
FGC13526
FGC13528
FGC13529
FGC13530
FGC13531
FGC13532
FGC13533
17042069-A-AT
FGC13534
21239052-AGGCCTGGCCGAATTGCGGGCAGGC-A
21661590-C-A
21661603-G-C
22115460-G-GT
22235591-C-T
FGC13536
FGC13537
FGC13538
FGC13539
2823651-G-A
7890306-G-A
8160585-A-G
9156901-T-C
M2782
M2783
M2784
14254578-G-A
14593897-A-T
15089945-A-C
15955832-C-G
16386405-C-T
16539113-A-G
17847902-A-G
18252169-C-G
18582423-GA-G
18701409-A-G
18985376-A-T
19049037-A-C
19070126-A-C
19123409-A-C
19430712-G-T
19477055-C-T
19477273-A-G
20035695-A-G
20814912-C-G
21265267-C-T
21931924-A-G
22084547-A-C
22473959-C-T
22536172-C-A
22554570-G-A
22886695-G-T
23139032-T-TA
28789570-G-A
CTS1751 S3666
Z17966
Z17967
Z17968
Z17969
14505108-T-C
15401587-C-T
17133678-T-A
17757799-G-A
S1447
17940388-T-A
18130084-C-G
18765090-T-C
21402261-G-T
21938654-T-C
22144855-A-G
22238853-T-C
22445303-C-T
22460463-A-G
22489146-C-A
22632907-T-C
23275589-G-T
24081244-A-G
24416429-T-C
26279374-C-T
2887753-C-T
6735149-C-T
6932218-T-C
7203236-A-G
7274352-T-C
7356592-C-G
7356596-T-C
7653015-A-T
8265951-G-A
8407500-G-A
8648231-T-G
8861184-C-T
9854715-A-G
2712982-A-ACCT
7407053-C-A
8059533-G-T
8101674-C-T
8140933-C-T
8376978-G-A
8503786-C-T
9015087-A-G
9850032-T-G
13200022-G-T
13852842-G-A
14838753-T-G
14847603-C-T
15933395-A-G
16497208-C-A
16717174-G-T
17233177-A-G
17239918-G-T
18646345-A-G
18752368-A-G
S22219
22157657-T-C
22242796-A-G
22711460-T-TA
23150240-C-T
23191365-G-C
23267677-C-A
23473552-G-T
7473013-C-T
8354552-G-C
9422290-C-A
13814112-T-C
14871849-G-A
14996409-G-C
15048065-C-G
15613489-G-C
15830093-T-G
15991175-G-A
16639226-G-T
16954805-A-G
17275756-GAA-G
18760899-G-A
18849699-G-A
19022805-G-T
19534437-A-G
20816515-C-G
20816516-A-G
21294548-G-T
21306704-T-G
21684497-C-G
21981004-T-C
21994805-C-T
22238816-G-A
22238935-C-G
22462452-A-G
23259544-G-A
23571681-C-G
23587955-G-A
CTS11994
FGC13745
FGC13760
FGC13743
Z18598
FGC13768
FGC13750
FGC13765
FGC13748
FGC13762
FGC13766
FGC13742
FGC13757
FGC13755
FGC13751
FGC11224
FGC13744
M660
FGC13752
FGC13756
FGC13758
FGC13763
FGC13764
FGC13767
FGC13769
8759324-C-T
15588369-G-A
16252139-G-A
17006768-A-G
18781588-T-G
22301243-G-C
22836152-T-C
22931896-CAAA-C
FGC11134
FGC12055
CTS4466 S1136
S1120
CTS3974 CTS3974
S1122
CTS5714 S1137
S1128
Z16247
CTS11267
A149
S1113
S1115
Z16248
Z16249
A81
A215
Z16250 A146
A115
A114
Z3028
S1121
Z16251
Z16252
A159
Z17981
A664
Z17982
Z17983 BY149
Z17981?
Z17983? BY149?
6805301-TGGC-T
15909667-G-A
18587252-A-C
23099561-G-T
23129121-C-T
24079370-T-C
13834949-A-G
18983182-A-C
19036943-G-A
19445915-C-T
22270810-C-T
22471458-G-T
22490382-G-T
28205875-C-T
6957380-A-T
8098692-G-A
9016756-A-C
14078196-T-A
14078260-G-A
15575562-C-T
15667461-T-C
18600000-A-T
18643663-G-T
22246706-T-G
22445722-C-A
23423771-C-G
Z17981?
6808308-AT-A
7561501-C-T
8563806-G-A
14432512-G-A
15362783-C-A
16418186-G-A
16894137-A-C
17203770-A-C
17389758-G-A
21499624-G-A
22461956-G-A
22470563-C-A
23415657-TTTT-T
23415661-TA-T
8282189-A-G
8529675-A-G
9378241-C-T
14046320-G-A
14209840-T-C
14709943-G-A
P98
15481079-C-A
17525312-G-A
18823829-G-A
21483772-G-T
23156618-A-G
23619222-G-A
Z18170
A150
8502568-C-T
15305843-A-AT
17179671-C-G
18803042-G-A
19039551-C-T
21454842-A-T
Z20763
23969850-C-A
FGC11145
FGC11150
Z17984
FGC11152
8110520-A-T
FGC11146
FGC11148
FGC11155
7671157-A-G
Z20764
20064139-C-T
23315634-G-A
6879379-T-C
7744946-G-T
8081939-A-G
9518557-C-T
15226456-G-A
16442284-T-TA
18061519-C-T
21136548-G-A
21163931-A-C
21529989-A-G
21595176-G-A
S1126
S1129
A542
A543
8601423-T-C
8695324-T-C
8697266-C-T
9439282-A-G
14918253-T-C
17114747-T-C
22294285-C-A
22992232-A-G
13835394-C-T
14594009-C-A
17841546-A-G
18093499-C-A
21180273-G-T
24430605-G-T
8529376-C-T
7677663-T-C
15066721-C-T
15066727-G-T
15066728-ACC-A
15859138-C-G
16647280-G-A
18149661-C-A
21785555-C-A
21905072-G-T
22633051-A-T
23147276-A-G
23204012-C-T
7553603-G-A
17717713-T-A
21265665-T-G
21484122-G-A
21877620-C-T
7591125-T-G
Z20766
13834288-TATGGAATGGACTGAA-T
15087791-A-G
15632934-T-G
17210572-A-T
23000123-C-T
2859831-C-T
9414738-G-A
17692978-G-A
17878633-G-T
8513129-C-G
13720455-A-G
14664392-T-A
15981623-A-G
16840403-T-C
17853383-A-C
19143696-T-C
19505932-G-A
21084721-T-TA
21084723-C-T
21399324-A-T
22771501-T-C
23480128-T-C
8386583-T-TA
13684693-C-A
14582053-A-G
17919728-A-AT
18548284-C-G
8475092-T-C
8766821-A-G
16871170-T-G
17694573-G-A
18394289-G-A
18563450-T-C
18944819-C-T
22814475-T-A
23642701-T-TA
27216648-G-T
28784253-A-G
L270
Z16518
Z16519
Z16520
Z16521
Z16522
M4291
25281992-T-C
24150526-G-A
9448128-C-T
9647965-T-C
9895861-G-A
14309969-G-A
14375417-CAGAG-C
14844250-G-T
16431842-C-T
21131612-C-T
23861738-A-C
8218027-TTC-T
17022390-C-T
17771752-C-T
17847943-A-G
2849084-A-AT
9964891-C-T
14505089-G-A
14656952-G-A
15309008-C-G
15656011-G-A
16181478-G-C
CTS5812
18424921-A-G
21390114-G-T
21707963-A-G
8374265-T-A
9763176-A-T
13861745-T-G
15220018-C-T
16261975-C-T
19193498-T-G
20811296-C-T
22830084-G-C
23567102-G-T
Z21065
Z16253 A195
Z16254
A154
A153
Z16255
Z17554
15158253-A-G
16553183-G-A
17417551-G-A
22272472-T-A
FGC6628
LLB17142
8367591-G-A
9398466-CAA-C
15715565-C-T
17664159-G-T
17973661-G-A
19349160-G-A
L1312
7584701-C-T
14200095-C-T
14200137-G-T
16713767-C-A
23148572-A-C
7145181-G-GAA
7198570-A-G
8509257-G-A
8518700-A-G
8884992-T-C
14049270-C-A
14423318-C-A
15105512-C-T
17666306-G-T
FGC11858
22602669-A-C
A88
6918611-G-A
7582874-C-T
7992927-C-T
14158403-T-C
15552921-G-A
15552922-C-A
16250307-C-G
17736267-T-G
21961294-G-A
17037393-C-A
8069703-G-T
8305301-C-T
8554214-C-T
8969165-T-C
9005803-T-A
9087247-C-T
14754980-C-G
15845018-C-T
16783830-AAAG-A
18808270-T-C
21565313-G-T
21627234-C-A
22470069-T-C
22476169-C-G
23054006-A-G
23610336-A-C
22294594-A-T
A89
A90
Z16256
6752764-G-A
10004201-A-AT
13567535-AAA-A
13567538-AG-A
13682801-G-A
14210399-T-A
14745793-CT-C
14826679-G-A
16901266-T-C
18841282-A-G
23537121-G-A
23567128-C-A
A155
A156
Z16257
A157
A158
15845118-C-T
20818501-TG-T
22446107-C-T
7252405-AAAC-A
9469099-A-AT
22478461-T-A
2744031-T-G
7594415-T-C
14322105-C-T
16966540-T-A
19135523-T-C
22028351-G-A
22460518-C-T
23844699-A-G
Z16258
13818866-T-C
Z17985
Z16259
ZS4589
ZS4590
ZS4591
ZS4592
ZS4593
ZS4594
17742861-G-A
18804525-A-C
19172667-C-G
21647254-G-A
23785936-A-T
14171321-C-A
16771474-A-G
18903217-A-G
7951688-A-G
14099412-C-T
15172093-T-C
15747281-G-A
18966504-C-A
22263336-T-C
26262589-T-TAC
28803926-A-G
28803937-C-A
8361437-G-C
15980847-G-A
16250080-T-C
18916010-G-A
19526778-T-G
23241633-C-T
24002568-A-C
2753260-C-T
6857343-C-T
7015015-C-T
7750743-A-G
7750748-T-C
7780340-G-A
9163164-G-T
13674605-G-A
15551059-G-A
16645437-A-G
17223987-T-C
19315028-G-A
19315667-C-A
22461173-C-G
22557430-C-T
22652755-G-T
23243868-G-A
24482919-A-T
PR204
7583766-C-A
8483298-A-G
8646245-G-A
14652834-T-C
15965183-A-G
16774945-A-G
S1127
19106459-G-T
22486679-G-T
23194605-GC-G
23194610-G-T
23898750-C-A
Z16250? A146?
A114?
A151
A152
Z17986
Z17987
A661
Z17988
A662
14026417-G-A
15479806-A-ACAACTAT
16402785-C-T
17005663-G-C
18416250-C-T
LLB17141
S7505 CTS2771
7623238-C-T
8801214-C-T
20828580-A-G
21396543-G-A
22009213-C-G
23021378-C-G
9814178-C-A
PF3339
7529018-T-A
8400821-G-A
9378130-C-G
9849408-C-G
15830223-G-A
17583039-C-T
19110751-T-C
22566510-G-T
9312100-G-A
28790905-C-A
A714
A715
A716
A717
7970628-C-T
8573216-C-G
9903234-G-C
14841557-T-G
17674122-A-G
22228457-C-A
22462339-C-A
22469087-A-T
22470729-T-G
23629999-C-T
6973266-AATT-A
15068173-C-G
15811958-G-A
16761456-G-T
17340021-G-T
22054773-C-T
22578807-G-A
18787818-A-G
18903235-G-A
18966024-T-TTCCA
21571475-C-T
23246011-C-G
23755138-C-T
23761672-A-AAGC
23968526-T-C
Z17989
A663
Z17990
13813246-G-A
13836505-A-G
14914132-G-A
15145958-C-G
15190358-G-GTT
15381961-G-A
17439025-C-T
FGC3281
17815763-C-T
19320781-A-G
21667463-A-G
22246545-C-A
22293764-TC-T
22464715-G-A
22945321-C-G
23646847-T-C
7663712-C-G
7777567-C-T
7883071-A-C
8405587-A-G
8537060-C-T
8880267-G-A
M4320
16267900-T-C
16577496-A-G
17529325-G-A
22140881-G-T
22513575-C-T
22787475-G-C
22936218-T-C
A206
7367197-CCTT-C
A207
A208
A210
15814116-CCAGA-C
A211
16221757-C-CT
A212
A292
A293
A213
A214
A216
A217
A218
A222
A286
Z17555
Z17991
Z17992
Z17991?
8145495-G-A
8261279-C-T
8612555-G-A
8781581-G-T
9021215-A-G
9022570-C-T
9086834-C-G
14048782-T-C
14049364-T-C
14298400-C-T
15273127-C-G
15358451-GC-G
16696078-G-C
16789042-G-A
17206250-G-A
17339922-C-A
18656494-A-C
19436311-G-A
19482821-T-C
21231060-C-T
21892669-C-T
23031940-T-C
23544044-C-G
23626645-C-T
23828630-C-A
24553539-C-G
28804975-C-T
FGC18022
FGC17135
FGC18024
Z17993
FGC18025
FGC18026
FGC18027
FGC18028
FGC18029
Z17994
FGC18030
FGC18031
FGC18032
FGC18033
Z17995
FGC18035
FGC18036
FGC18037
FGC18020
Z17996
Z17997
FGC18038
FGC18039
FGC18040
FGC18041
FGC18042
Z17991?
Z17555?
FGC18021
FGC18023
16966284-C-G
FGC18034
22242313-A-T
23960818-AG-A
7426410-G-C
7784397-G-T
8981421-G-A
9866651-T-A
13829917-A-G
14042236-G-T
17328385-G-C
17818090-T-C
19381083-A-G
22461899-G-A
22553649-G-T
23323059-A-C
24422343-G-T
Z17992?
6126095-A-C
7849380-A-T
8672288-A-G
8686224-A-G
8845437-G-A
9118698-A-C
9815326-C-A
13655788-A-C
13666670-C-T
13716899-A-C
14176651-G-C
15045816-C-T
15270917-T-C
16275217-C-T
16443068-C-T
17479701-G-A
17935701-C-T
18053193-T-A
18839442-C-A
19278606-G-A
21238914-C-T
21326637-C-T
21330018-G-T
21370868-T-A
21927598-A-G
22474335-C-T
22685531-A-G
22927184-C-G
22968676-G-C
23580688-T-C
FGC11256
FGC11257
FGC11258
FGC11259
FGC11260
FGC11261
FGC11262
FGC11263
FGC11264
FGC11265
FGC11266
FGC11267
FGC11268
FGC11269
FGC11270
FGC11271
FGC11272
FGC11273
FGC11274
FGC11275
FGC11276
FGC11277
FGC11278
FGC11279
FGC11280
FGC11281
FGC11282
FGC11283
FGC9101
FGC11284
FGC11285
FGC11286
FGC11287
FGC11288
FGC11289
FGC11290
FGC11291
FGC11292
FGC11293
FGC11294
FGC11295
FGC11296
FGC11297
FGC11298
FGC11299
FGC11300
FGC11301
FGC11302
FGC11303
FGC11304
FGC11305
FGC11306
FGC11307
FGC11308
FGC11309
FGC11310
FGC11134?
Z16250 A146
L96
2886371-C-G
7557005-C-T
8220178-T-C
8556860-C-T
8599944-T-TT
13602073-G-A
13842327-G-A
15241611-G-A
15713267-A-G
16369378-A-G
17750750-T-C
17764380-C-G
18765682-A-C
18896423-T-A
PF2542
21654260-A-G
22179486-C-A
22483178-G-T
23238453-C-A
23435361-T-G
23576600-T-C
23830760-T-G
24358838-G-T
26011431-T-C
26219497-G-T
26274253-GC-G
28236744-C-T
28733101-G-T
DF21 S192
FGC3213
P314.2
Z16524
Z16526
Z16832
Z16527
Z16528
FGC18205
Z16529
Z16530
Z16531
Z16532
Z16534
Z16535
Z16536
FGC19883
L362 L294 S312
ZS4595
ZS4596
ZS4597
ZS4598
ZS4599
ZS4601
ZS4602
ZS4603
ZS4604
ZS4605
ZS4606
ZS4607
ZS4608
ZS4609
ZS4610
ZS4611
ZS4612
ZS4613
FGC12099
ZS4600
6631928-T-C
9746643-T-A
15895598-C-A
17030522-C-G
19503680-A-G
22846885-C-T
8615335-G-C
FGC1058
17892693-T-A
Z16533
Z16537
FGC19884
8644218-C-A
9479802-T-C
14499256-T-TT
16637555-T-TT
L849
FGC19885
FGC19887
FGC19889
FGC19890
FGC19891
FGC19892
FGC19893
Z16523
Z16525
Z16538
FGC19883?
FGC14748
F4140
M7449
FGC14750
14853139-A-AA
FGC14751
FGC14752
FGC14753
FGC14755
FGC14756
FGC19883?
2762492-TT-T
FGC18204
8214827-T-C
FGC18206
FGC18207
FGC18208
21298239-G-C
FGC18209
FGC18210
S3058
FGC3213?
2738040-A-C
7717855-C-G
7857684-G-A
8013550-C-A
8203770-C-G
8443110-G-A
8603261-T-C
F3906
F1621
13240060-C-T
13673262-A-G
14482079-G-T
14504451-C-T
15705862-C-T
15825581-C-T
16086483-C-T
16916184-G-T
17071671-C-T
17082534-A-C
17086579-AATT-A
17517710-C-CA
18081161-G-A
18257061-G-A
18666615-A-G
18939717-A-G
18994634-CA-C
19037707-A-G
19255020-C-A
21495190-A-T
22206430-G-T
22263382-A-T
23195596-AG-A
27823591-G-A
27838948-G-T
S424
S426
S3025
S3026
S3031
S3057
FGC3207 S423
S3106
M11795-?
S3032? FGC3184?
PF4673?
S309? FGC3185?
Z16260?
FGC3215?
FGC3209?
FGC3195?
Z16261?
S27825?
S301? FGC3208?
S3020? FGC3178?
S27821?
FGC3180? S27822?
S3029?
FGC3183? S27823?
S27826?
FGC3194?
FGC3205?
FGC3210?
Z16262?
Z16263?
FGC3186?
FGC3213?
PF678?
S190 CTS2187
S3027
M11795-
S3032 FGC3184
S308
S3034
PF4673
S309 FGC3185
Z16260
FGC3215
FGC3209
CTS9333 S307
S427
FGC3195
S3028 Z633
Z16261
S27825
S301 FGC3208
S3020 FGC3178
S27821
FGC3180 S27822
S3029
FGC3183 S27823
S27826
FGC3194
FGC3205
FGC3210
Z16262
Z16263
FGC3186
PF678
ZZ23
ZZ24
ZZ25
ZZ26
Z17999
Z18000
FGC3101
Z17998
7790940-C-T
9973909-G-A
21441595-C-A
15088600-A-T
18257599-C-T
19536319-C-T
19286933-C-A
15138815-GACTA-G
16610603-CA-C
16286451-C-T
19055020-G-C
22818414-C-T
22962322-G-A
5910947-C-T
7771924-A-G
8521514-C-T
ZS218
14599208-T-C
15028763-A-G
15859345-A-G
18826054-G-C
18882956-AT-A
21705830-T-G
23631937-A-T
23817229-A-G
6135105-A-C
6707055-T-G
7923428-C-A
7979417-T-C
14883178-G-T
16374138-G-T
17865762-C-T
21213812-T-C
23548451-T-C
3074428-CT-C
6871604-A-G
7978045-T-A
8474700-G-A
9764318-GAA-G
14724064-T-C
15249534-A-G
15978239-A-G
16404419-G-A
16455403-G-A
16790516-T-G
FGC3197
FGC3200
FGC3212
FGC3216
Z16446
Z16447
Z16448
FGC3193
FGC3192
FGC3196
FGC3198
FGC3199
FGC3201
FGC3202
FGC3203
FGC3204
FGC3206
FGC3211
FGC3214
FGC7854
8309272-G-T
8309577-G-A
13663960-T-A
15344336-T-C
16913946-C-T
17189720-G-A
18114412-T-C
18910415-C-T
19165377-TC-T
S3033
S425
S422
S302
S421
S303
S3068
S420
6843217-C-A
7399102-A-G
8146791-T-TA
9815938-C-T
9868411-T-C
13717221-G-T
17489405-C-G
17578390-C-A
17906475-C-T
22475424-A-C
S5456
S5470
S6295
S5460
Z17571
Z17572
S5478
S5483
S5452
S5468
Z17578
S5480
S7133
Z17579
S5476 PF1786
S5459
S5453
S5481
S5451
S6166
FGC11955
Z17573
Z17574
Z17575
Z17576
Z17577
S6296
FGC11922
FGC11932
FGC11933
FGC11938
FGC11939
FGC11944
18904419-A-C
FGC11946
FGC11947
FGC11948
FGC11951
FGC11954
25354444-G-A
FGC11923
FGC11924
FGC11925
S6163
FGC11928
FGC11934
FGC11935
FGC11936
S5475
FGC11941
FGC11942
FGC11943
FGC11945
FGC11953
FGC11926
FGC11929
FGC11937
18174880-CAG-C
FGC11956
FGC11947?
7072835-C-T
7560537-G-A
7880151-CAA-C
8466667-G-C
13490101-A-G
14542666-G-A
16375337-C-T
16779295-AC-A
17351969-G-A
17395122-A-T
18208451-C-T
23317686-TG-T
26249381-T-C
S5199
S5201
CTS8704 S6375
Z1928 (also known as CTS2733)
FGC9722
FGC9723
FGC9724
FGC9725
FGC9726
FGC9727
FGC9728
FGC9729
FGC9730
FGC9731
FGC9732
FGC9733
FGC9734
FGC9735
FGC9736
FGC9737
FGC9738
FGC9739
FGC9740
FGC9741
FGC9742
FGC9743
FGC9744
FGC9745
FGC9746
FGC9747
FGC9748
FGC9749
FGC9750
FGC9751
FGC9752
FGC9753
FGC9754
FGC9755
FGC9756
FGC9757
FGC9758
FGC9759
FGC9760
FGC9761
FGC9762
FGC9763
FGC9764
FGC9765
FGC9766
FGC9767
FGC9768
FGC9769
FGC9770
FGC9771
FGC9772
S280 Z246
DF25 S253
2810149-G-A
7531696-C-T
7695021-T-C
8798273-G-C
9850550-A-G
13205761-G-T
14044527-G-A
14115549-G-A
14203101-G-A
14944132-G-A
15025368-TG-T
CTS3849
15612580-A-C
15718826-C-A
16254942-C-T
16339769-T-A
16567175-C-T
16737324-A-T
17744077-T-C
17846770-A-C
17866608-G-T
17905236-AT-A
18384928-G-A
18994787-G-A
19093960-A-G
21147695-T-C
21173130-T-TA
21177810-C-CTCTACCTCTGAT
21839538-C-T
22239149-G-A
22466221-C-G
22470372-C-T
23561243-A-G
24394686-C-A
26646057-A-G
2903684-C-G
4002747-C-T
6960233-G-A
7695567-C-T
8041816-A-C
9130342-C-G
9162513-G-A
9843408-T-C
14952896-T-C
S4858
17138722-T-C
17141555-A-G
18122313-G-A
18802649-G-T
18843509-T-C
19021074-C-G
19167004-AA-A
19304508-C-T
20816194-T-C
YSC0001037
21874304-C-T
21891532-C-T
21928955-A-G
22206208-AG-A
22245998-C-G
23551469-G-T
24001794-G-A
24419119-C-T
28621055-A-G
2889552-G-C
S6191
S6189
7405498-T-A
7880466-C-A
8055001-G-A
8180178-C-T
8425371-T-A
8575652-A-G
8624570-A-T
9007014-A-G
9035436-A-G
13662136-A-G
13675181-C-A
13807398-C-T
14322206-A-G
14418371-C-G
14587002-C-T
14852026-T-C
15177357-A-G
15406358-C-CA
16347655-T-TA
S7211
17649521-A-T
18048562-C-T
19067542-C-T
19447135-A-C
20686051-A-G
21052562-G-A
21809051-G-A
21811250-G-A
21817139-T-G
S6168
22272838-G-T
22459489-A-C
22479585-G-T
22954470-T-C
23633252-G-A
23977520-G-A
S281 Z248
DF5 S191
Z17556
FGC3899
L658
F15
FGC8018 YSF050791
FGC5752
FGC5761
FGC5762
FGC5763
FGC5764
FGC5765
YSF050805
FGC5768
FGC5769
FGC5771
FGC5775
FGC5777
FGC5778
FGC5779
FGC15496
FGC5780
YSF050864
FGC5783
FGC5784
FGC5785
FGC5794
FGC5795
FGC18211
FGC8019
FGC5759
FGC5772
FGC5774
FGC5776
FGC5786
FGC5787
FGC5753
FGC5788
FGC5754
FGC5755
FGC5756
FGC5757
FGC5758
FGC5760
FGC5766
FGC5767
FGC5770
FGC5773
FGC5781
FGC5782
FGC5789
FGC5790
FGC5791
FGC5792
FGC5786?
FGC15489
FGC15490
13680820-GGAAAT-G
FGC15492
FGC15493
FGC15494
FGC15495
FGC15497
Z16327
CTS3655 S3787
FGC3902
Z17556?
L627
L626
L625
FGC3901
FGC3904
FGC3905
FGC3906
FGC3907
FGC3908
FGC3909
FGC3910
FGC3911
FGC3912
FGC3913
FGC3914
FGC3915
FGC3916
FGC3917
FGC3918
FGC3919
FGC3920
FGC3921
FGC3922
FGC3923
FGC3924
FGC3925
FGC3926
FGC3927
FGC3928
FGC3929
FGC3930
FGC3931
FGC3932
FGC3933
FGC3934
FGC3935
FGC3936
FGC3937
FGC3938
FGC3939
FGC3940
FGC3941
FGC3942
FGC3943
FGC3944
Z16539
Z16540
6932851-G-A
7526763-G-A
9386777-G-C
14373954-G-A
14436274-T-C
14597737-C-G
15035246-G-C
15139151-C-A
15738055-A-T
17120719-T-G
17184658-CT-C
V75
18074568-G-T
CTS10135
20653625-T-C
21439691-G-A
21549504-T-A
21568868-C-T
21649796-C-T
22458798-C-T
22686574-A-G
23002919-C-G
23530906-G-A
23994933-T-G
3409368-T-G
6742129-G-T
M9605
8617720-T-C
8728385-G-T
9062448-G-A
13802663-G-T
14145463-C-T
14891220-C-G
14999735-C-A
15461848-G-A
15900960-C-G
16088754-C-T
19370801-A-C
21045972-T-A
21859144-C-T
22957218-C-T
23135802-G-A
28649862-C-T
17110548-T-C
7941777-T-C
14224525-A-C
14252712-C-A
14865412-A-C
16890327-G-A
18179248-G-A
18750715-T-A
19126276-C-CA
21331991-A-G
22846098-C-T
Z17556?
FGC3899?
FGC15499
FGC15500
FGC15498
FGC15501
FGC15503
L1446
L1447
10017104-G-T
FGC15505
FGC15507
FGC15508
FGC15509
FGC15510
16284770-G-GAGCC
FGC15511
CTS8595
FGC15512
FGC15513
FGC15514
19394648-CACTG-C
FGC15515
22437498-CT-C
22468662-G-A
FGC15516
FGC15517
FGC15518
FGC15519
FGC15520
FGC15522
L1403
Z16264
Z16265
Z16266
FGC3899?
2853889-A-T
6946276-T-C
7213608-TTAAA-T
A419
F4092
8533779-T-C
9503492-G-A
13647008-G-C
13677368-C-T
13820638-G-A
A418
15144654-C-G
15216613-T-A
15217633-CTG-C
15275898-A-G
18718509-T-G
20802358-C-T
21258992-C-G
21398391-T-A
21414989-GA-G
PF1052
21773361-C-T
22296368-T-C
22463510-C-T
22619174-A-T
22680490-G-A
23153994-G-A
23389568-G-T
23893711-C-T
15823518-TTGGGAGGCAAGGGTGGG-T
28745423-ATATG-A
9419249-T-G
L1402
Z16833
Z16834
Z16835
Z16836
Z16837
Z16838
Z16839
Z16840
Z16841
Z16842
Z16843
A385
17944303-T-C
22865249-A-T
17944303-T-C?
7900424-T-C
8588499-AGGCT-A
15858743-G-A
A420
17508000-G-A
A421
21563373-CA-C
21817769-C-A
22256390-G-C
22420143-G-A
A459
A682
8707891-T-C
A422
22246469-G-T
22246470-A-T
7848235-G-T
13864745-G-A
16334113-C-T
21292336-T-C
22263210-A-T
2804150-C-T
13661528-C-T
13849662-G-T
14078815-G-C
A423
14412003-T-C
14913024-C-A
S4631
15991851-C-G
17649601-C-T
17712425-C-T
19409627-C-T
A424
22437420-G-T
22444030-G-T
22464493-A-C
22484319-C-T
22716382-G-A
A454
24475501-A-G
25430112-T-A
A426
A728
7850852-C-T
A425
18744078-CT-C
21545313-T-G
23598970-T-C
23968419-A-T
PF5457 M367
PF5458 M368
A712
A713
23450238-G-C
23508030-C-T
8520696-A-G
M11203 CTS1807
14144271-T-C
14208509-TC-T
15302858-C-T
15784107-T-G
16901249-C-T
18102496-C-A
19165462-G-A
22563492-G-C
22918482-C-T
22932387-G-A
S971 Z3017
Z16267
ZZ3
ZZ4
6138451-A-G
6679601-G-A
6720249-A-T
6988797-C-A
7167564-G-T
7672357-C-T
7778386-A-G
8126659-C-T
8435166-A-T
8806643-C-A
8877260-G-A
13827203-C-T
14124277-C-T
15144835-T-G
15419100-A-G
16258808-G-T
16852393-T-G
17354378-T-C
17361774-C-G
17514472-G-C
17656466-G-T
18664827-A-G
18694469-A-G
18885814-C-A
19233874-G-A
21085762-A-G
21384992-C-A
21397751-A-G
21568638-T-C
22097727-G-A
22458347-C-T
22610363-C-G
22753185-C-T
23042597-C-A
23053200-G-A
23308096-A-AC
23389946-T-A
24414608-T-C
24751667-G-A
28019379-G-C
S954 Z3003
S957 Z3005
Z16268
S964 Z3010
S966 Z3011
S967 Z3012
A60
S968 Z3014
A62
A63
Z3018
Z16269
S3862 Z3020
Z2993
S951 Z3000
A51
Z3002
Z3019
S960 Z3007
Z16271
10040518-C-T,G
Z16270
Z18003
Z18004
Z18005
Z18006
Z18007
Z18008
Z18009
Z18010
Z18011
8614547-G-C
15040332-A-G
18918822-C-A
19219990-A-T
21784543-C-T
22293770-T-A
22293773-G-T
23443679-T-C
23475127-T-A
7688394-C-T
14061608-G-C
16949912-T-G
8667394-TA-T
8828266-G-A
8972873-G-A
14426107-C-T
14551261-T-G
15104546-G-C
15512101-G-C
17005740-G-A
18398563-C-T
19087871-A-G
21372440-C-T
21726031-A-G
22445457-T-A
22458122-C-A
23044391-A-AT
23473420-T-C
2742329-C-T
2980894-CTATT-C
14786957-A-C
15041985-T-C
16679670-G-A
16960223-C-T
21288166-C-T
21479324-C-A
22475649-C-A
22964630-A-G
23098494-C-A
22474380-A-G
S9397
7157376-C-A
7157378-A-T
8413106-T-C
8645287-T-A
9155064-A-C
14173334-C-G
14209677-C-T
14299007-G-A
15703067-C-G
18052077-A-C
21398675-C-A
22480456-C-T
26544633-A-C
28590198-C-A
FGC6618
7948648-T-G
14287215-C-A
14915068-T-C
16583094-G-A
17335225-T-G
17661386-G-T
19107768-T-C
21766570-A-G
22272602-C-T
22582829-C-T
S959 Z3006
2758946-A-C
6465109-G-A
7050815-G-T
7271894-T-C
M6554
7704287-C-T
13656040-G-T
13674049-C-A
14375733-GAGAT-G
16522306-C-T
16564168-G-A
16757384-A-C
16794758-G-T
17980199-T-A
18593698-A-G
18825905-T-C
19380029-T-G
22553576-A-T
23607561-G-A
S956 Z3004
S962 Z3008
Z16274
Z16276
Z16279
Z16278
Z16273
Z16277
Z16272
Z16275
A77
Z16280
Z16271?
7839686-C-A
8607555-C-T
FGC19634
16370638-A-C
23481764-G-T
23481765-C-T
7234010-G-A
7643541-A-G
7816559-C-A
9796361-T-C
18425680-G-A
19532260-T-A
21450947-G-A
22473432-T-G
8349046-C-A
14320288-T-C
16566770-G-T
21092536-T-C
22471306-T-A
15578406-T-C
16393461-C-T
16597616-G-C
17762054-C-T
18269405-G-GA
23479700-T-C
23760044-G-A
24380546-T-A
6768744-G-C
8481556-C-G
15047182-C-T
17769610-C-T
21214842-G-A
22183526-T-G
23247066-T-C
14030764-G-A
14368069-C-T
16497274-C-A
16848917-G-T
18544960-A-G
22215416-A-G
22747692-C-G
22748794-C-G
23865993-C-T
S953
ZZ2
22278001-T-A
22423330-A-T
ZZ13
ZZ14
S953?
2668329-G-A
8193514-G-A
14343608-T-C
16243549-G-A
16341855-A-G
21425928-T-C
22470075-T-A
24463516-G-A
6757027-T-C
6757027-T-C?
6734552-A-G
6794213-A-G
22634854-C-T
23022739-T-A
15279589-C-A
17979168-G-A
4875125-T-C
9109042-A-G
15463615-C-T
15667765-C-A
16953308-G-T
18114980-T-A
19011496-G-A
19033203-G-T
21406580-C-T
22246418-C-A
Z16271?
13666880-G-A
13675640-C-G
17463811-A-C
Z16271?
6879606-T-G
26201543-G-A
8424676-C-A
9646350-G-C
14358670-A-C
14839640-G-A
17705431-C-T
18019516-G-GTA
18647271-C-A
7357618-T-A
9149296-C-T
9771576-T-G
15424655-G-T
18725233-G-T
18829662-T-C
19003170-G-A
19096444-G-A
21190677-C-T
23247477-G-T
S953?
8009839-G-T
10021209-C-A
16660179-T-A
21287206-A-T
22753374-T-G
22824727-A-G
22917993-C-G
7554940-G-A
7624986-G-A
8507554-T-A
9869541-C-T
9903340-C-G
14319646-A-G
16753688-G-A
18789239-G-A
22445549-C-G
22736327-A-T
22737096-G-A
23579797-C-T
28757334-C-A
S3859
13822719-A-C
17489340-C-A
18926319-A-G
22445471-G-T
22460673-G-A
S3865
14286300-G-A
8634059-C-A
16229898-C-T
17604616-T-C
S3858
S3874
F4142
18890475-A-T
22470163-T-G
9537473-CAG-C
13824327-G-A
16968066-C-T
17848212-G-T
18706636-A-C
22446024-G-T
22457398-G-T
23955523-T-C
2700534-A-T
6878539-A-C
8266018-G-T
8375326-G-A
14433223-G-A
14769497-C-T
15035627-T-C
16576436-A-G
16655932-G-C
17030056-A-G
17613923-CA-C
22444603-G-T
23861057-C-T
S5488
Z16294
Z16281
Z16282
Z16284
Z16285
Z16286
Z16287
Z16288
Z16290
Z16291
Z16292
Z16293
Z16295
Z16296
Z16283
Z16289
9851256-T-C
15110500-G-C
16297603-A-G
16378382-C-G
17657284-G-A
CTS8429
18166961-G-A
18354291-G-A
18354326-A-C
19124488-G-C
21368155-C-T
21701006-C-A
22480189-C-A
23449530-C-T
14947486-C-G
21653598-T-TA
22462361-C-A
2704529-G-A
8379367-T-G
9158813-T-G
13673478-T-C
13804508-C-T
14959241-G-T
17511509-A-G
18679663-A-G
21167689-C-T
24433351-C-G
8152282-G-A
8466139-C-G
15723659-C-T
16385405-C-A
18255599-C-T
23385769-G-A
Z18012
6102717-G-T
6104668-C-T
7172132-G-A
7693315-C-T
13864690-C-T
14062700-T-C
M7964
15066850-C-T
L199 PF5371
17977244-C-T
21715913-T-C
23576242-C-A
Z16283?
7871312-G-C
9861202-T-C
13458861-G-A
14323054-TT-T
19472350-T-A
19482832-A-G
22474294-A-T
22478917-C-G
22483715-G-A
22721707-C-G
23270562-C-A
2668518-T-C
7655087-A-G
8123584-A-T
8473324-CA-C
8752908-C-A
14546042-C-T
16635363-G-A
17665594-G-C
17669986-G-A
21694263-A-T
21871301-T-C
22442265-G-A
22459139-A-G
22460743-A-T
23515567-A-T
23647228-C-T
ZZ21
L130
7697238-T-C
7765399-G-C
8161521-T-C
8461628-A-G
9061167-A-G
9126944-G-A
9741354-T-C
13715810-G-C
14148684-T-G
14247652-A-T
14597238-G-A
S7837
15114520-T-C
16576356-G-A
16984728-T-A
17296439-A-C
17339741-CT-C
17340329-T-C
17505986-T-C
17624268-C-T
17668934-G-A
17854216-C-T
18889831-T-G
19338744-T-C
19374647-C-G
19458603-G-A
19537630-G-A
22003717-G-A
22003733-T-C
22650652-A-AT
23457750-C-G
23599534-A-G
25466659-GGAAGAA-G
26729547-G-A
3545000-C-A
7084683-C-T
7844822-A-G
8531009-C-T
8804254-T-C
8860300-G-A
9791753-G-A
14019271-G-A
14287663-A-C
14880873-CATTGTATT-C
FGC6410
17360145-ATCT-A
17675064-T-C
17940971-T-C
18866069-A-C
18943571-C-T
18943580-T-A
21399387-G-A
21591745-A-G
21646577-A-G
22440270-G-T
22461301-G-C
22553791-T-A
23234580-G-A
23247509-C-T
23589907-C-T
CTS12349
CTS12350
S7200
S5490
Z16297
L720 S299
Z16298
Z16299
Z16300
S10807
Z16301
Z16302
Z16303
Z16304
Z16305
Z16306
Z16307
Z16308
Z16309
Z16310
Z16311
Z16312
Z16313
Z16314
Z16315
Z16316
22468836-G-T
22468840-C-G
22468841-A-G
22468845-C-T
22468853-G-T
22468942-G-C
Z16317
Z16318
Z16319
Z16320
Z16321
7339646-G-T
14341206-G-A
15561698-GA-G
16072346-C-A
16807329-T-G
17684938-T-A
19446450-A-G
21485541-T-C
22167714-C-T
CTS12937
7902808-T-C
7952912-A-G
8019695-C-A
8102010-G-C
9148991-G-A
9763059-G-C
19008875-T-C
19536945-T-C
22468871-A-G
22468876-CAG-C
22468922-A-T
22468928-G-A
22468929-C-T
22468932-C-T
22468933-G-A
S6003
Z16541
Z16542
Z16543
Z17557
S6019
Z17558
Z17559
Z17560
S6000
Z17561
S6024
S6018
Z17562
Z17563
S7190
Z17564
8501642-CTTCTTCT-C
15465168-C-T
18769613-G-A
18899613-A-G
21288621-G-A
21814234-C-T
21859961-A-G
22440587-T-C
23499736-C-T
24393291-A-C
Z16542?
6715327-C-A
6992615-C-T
8703912-T-C
9435001-G-GC
9644159-G-A
14805058-T-C
15032351-T-C
15060321-C-A
16749742-G-T
17881529-T-A
19087695-G-T
19360801-C-T
22824873-G-A
23495438-C-G
23526608-G-A
24362735-AAAAATGGA-A
8123518-T-C
8139423-T-G
8662036-A-G
9674809-ATATT-A
15255769-G-T
16188411-T-C
16532486-T-C
16901983-T-C
17629945-C-T
17647620-C-T
17714549-A-G
F2605
17860973-T-A
18127219-C-T
18200389-C-T
21401169-TA-T
21401174-G-T
21559848-C-A
22029505-C-T
22740573-A-G
23888664-A-G
24510236-A-C
26594843-C-G
L1336
FGC11317
Z17565
Z17566
FGC11320
FGC11321
FGC11322
FGC11324
FGC11327
FGC11329
Z17567
FGC11334
PF5374
FGC11337
FGC11338
FGC11339
FGC11340
FGC11343
FGC11344
FGC11345
Z17568
Z17569
FGC11349
Z17570
FGC11358
FGC11361
8524817-A-C
17404184-C-A
17944005-G-A
18103492-C-T
18726614-T-C
22443069-G-A
22466282-A-C
6621145-G-A
6643573-T-A
6931362-C-G
7908853-G-A
13832374-G-A
14350422-G-A
14448695-G-T
15363826-C-T
16306276-G-A
17904615-G-A
18866242-A-G
20805936-G-A
22442956-C-T
23203623-T-TTG
23826178-G-A
2668748-T-C
8239069-G-T
16661927-G-A
16806446-C-A
23628216-C-T
FGC11311
FGC11312
FGC11313
FGC11314
FGC11315
FGC11316
FGC11318
FGC11319
FGC11323
FGC11325
FGC11326
FGC11328
FGC11330
FGC11331
FGC11332
FGC11333
FGC11335
FGC11336
FGC11341
FGC11342
FGC11346
FGC11347
FGC11348
FGC11350
FGC11351
FGC11352
FGC11353
FGC11354
FGC11355
FGC11356
FGC11357
FGC11359
FGC11360
FGC11362
FGC11363
FGC11366
FGC11327?
Z17569?
6946552-G-T
7082208-G-C
7270209-C-T
7270211-A-T
7527165-G-T
13655886-G-A
15340352-T-G
18680818-A-G
19990928-A-C
21221808-G-A
2904845-T-G
6152927-A-C
6670267-A-AA
7058183-A-G
7068224-A-T
7147451-A-T
7220549-A-G
7614365-C-T
7774961-AA-A
7835335-T-A
8249647-G-T
8841827-G-A
9880193-T-TT
13650843-G-T
14761492-A-G
15620893-T-C
15782386-G-T
17054892-T-C
17509943-C-T
17789107-C-T
18910258-T-C
18923596-T-A
22271048-T-G
22362258-G-A
22485684-T-G
23003876-T-C
CTS11522
23420766-T-G
23424115-T-C
23967907-C-T
2815666-T-G
2826972-G-A
6786036-C-T
7047019-C-T
7213634-A-G
7524107-A-G
FGC3946
7840756-A-AA
7921360-A-C
8306875-G-A
8529661-C-T
14035355-G-A
14082019-CTATC-C
14409754-C-T
14702282-G-T
15339475-T-C
15792459-A-T
15999465-C-T
16326462-TCCCTCCC-T
16880107-T-C
17102702-C-T
17152814-C-G
19024774-C-T
19079970-G-T
19277396-C-T
19524298-A-G
20830988-C-A
21372387-G-A
21400773-G-A
21766120-T-TT
22105351-G-A
22180127-T-A
22238785-A-C
22468623-G-A
23248012-C-T
24360230-A-G
CTS6581 DF41 S524
S839 Y2373
Y2370
CTS2501 S836
Y2374
Z17580
Y2368
Y2369
Y2371
Y2372
FGC5582
FGC5583
A41
FGC5586
FGC5587
FGC5589
FGC5590
FGC5594
FGC5597
FGC5598; site of M7301
FGC5605
FGC5612
FGC5615
FGC5617
FGC5565
FGC5592
A44
MC03
MC05
FGC5563
FGC5607
FGC5585
FGC5604
FGC5608
FGC5566
FGC5567
FGC5568
FGC5570
FGC5571
FGC5572
FGC5573
FGC15155
FGC5574
FGC5575
FGC5576
FGC5580
FGC5588
FGC5593
FGC8003
FGC5616
FGC5596
FGC5606
FGC5613
FGC5584
FGC5609
FGC5595
FGC5581
FGC5603
FGC5611
FGC5579
FGC5600
FGC5578
FGC5591
FGC5601
FGC5610
6839692-C-A?
L535?
13801050-AATTGG-A?
16179621-C-A?
CTS7649?
22284576-T-A?
FGC5569
FGC5577
FGC5602
FGC5614
8763128-G-A
13851147-G-C
15139178-G-C
16575735-G-T
22821520-G-A
FGC5579?
7933050-C-T
17646142-C-T
FGC5579?
FGC5600?
8704413-A-G
9859407-T-C
10007900-G-A
15344657-C-G
15355532-A-T
18916207-G-A
21344316-G-A
FGC5595?
3621899-T-G
8259008-C-G
9732542-T-G
14063766-T-C
15754337-G-A
17585246-CT-C
17585250-TA-T
18104272-A-G
19520473-T-G
23304215-T-C
23306336-G-A
23515364-C-T
MC07
MC04
MC06
MC08
MC09
MC10
MC11
MC12
MC13
22439895-G-C
22743447-ACCTCAGGTAATGCACCCG-A
23403856-CACAAACATAACAGGAAGTAATT-C
23885131-A-C
MC16
MC17
MC15
FGC15160
MC01
MC19
FGC15165
MC00
MC20
14243107-G-A
3436432-G-C?
6065152-A-AT?
L1274?
CTS653?
19040942-G-T?
FGC15154
FGC15156
FGC15158
FGC15161
FGC15164
FGC15166
FGC15153
FGC15157
FGC15159
FGC15162
FGC15163
18606317-T-G?
2650297-A-G
8975687-C-T
9036251-C-T
9046578-G-A
14879994-G-T
16453268-G-A
22445521-T-A
22462613-C-T
23159924-G-A
S775
Z18013
A600
6719450-A-AT
7608192-C-T
7790973-C-A
8480529-C-G
9504369-G-A
9849108-C-T
9850206-C-A
14137796-A-G
A291
17184146-G-A
17846486-T-G
17914287-T-TT
19103254-C-G
19220537-A-G
19234516-G-T
19368639-C-A
19368645-T-G
21111050-C-A
21149398-G-A
22577760-C-T
23535096-G-T
23554282-G-A
23776583-G-A
23992218-T-TT
25339485-G-C
27676297-G-A
6377565-G-A
13674017-T-G
13800015-CGAATGGAATGGACAA-C
13836002-C-T
14011019-G-T
15346678-C-T
15933557-C-G
16980291-A-G
18244997-C-T
18668636-C-T
19363467-A-C
19516412-G-C
19669074-C-CA
21310924-C-T
21929556-T-C
22471082-A-C
22601816-T-C
22733548-G-A
23305225-G-A
23812948-C-T
24268604-G-A
Z18013?
6941731-A-G
6965905-T-C
7619280-C-A
7677584-A-G
8455547-G-T
15785326-T-A
15787040-C-A
15978020-C-T
16711974-C-T
16877537-A-T
17809876-TACAAAAA-T
17873424-G-A
17947982-C-A
18619986-T-G
18633193-T-C
19024415-T-G
22235613-C-T
22445825-G-C
22466963-G-A
22478961-T-A
S788
S792
S798
Z16844
L745
Z16845
Z16846
Z16847
L746 S310
S799
S790
S785
S776
S794
S787
S786
S777
S780
S769
S784
S791
Z16849
Z16850
Z16851
S778
S770
17817399-TTATC-T
S802
Z16848
Z16852
Z17581
2767658-G-GT
6273648-G-GT
6857631-T-C
7900320-A-G
14159520-A-G
19103490-T-C
23967625-C-T
6888681-T-G
8810006-TA-T
2700617-A-G
14433917-G-A
21235438-G-A
22770783-C-T
23590416-A-G
Z17582
7647468-G-C
8353473-A-C
18811118-G-C
18980276-C-T
22242910-T-C
22242922-C-A
22242957-A-C
22785553-G-T
Z16852?
8717371-C-A
9401022-C-A
22262811-G-C
23633287-A-C
24305381-C-A
Z17582
Z16852?
S770?
22581952-T-C
15472219-G-A
17171411-T-C
S19861
19550246-G-C
21799747-G-A
S781
S770?
8650100-A-G
20806568-A-G
Z16852?
A309
A308
A306
A307
Z16852?
17423425-C-T
19093413-C-T
8439846-G-A
18026006-C-A
Z16852?
S770?
S802?
2655141-A-C
2819554-GA-G
8801784-C-T
10022499-C-T
15031439-CT-C
17362379-G-T
18202695-T-A
18750797-G-A
A572
23573483-A-G
FGC8621
FGC8622
Z17585
Z17586
FGC8624
FGC8628
FGC8633
M8251
A102
A103
FGC8637
A105
FGC8643
A107
FGC8647
FGC8648
FGC8649
Z17583
Z17584
FGC8652
22479173-C-G
22479205-T-C
22479210-G-A
22479213-T-A
22479232-G-A
22479234-C-A
Z17587
A112
A113
Z17588
Z17589
8187698-G-A
9897770-C-T
13311348-C-T
14938702-T-G
15031167-C-T
20628433-T-C
21396565-A-G
PF1109
FGC8625
FGC8608
FGC8609
FGC8610
FGC8611
FGC8612
FGC8613
FGC8614
FGC8615
FGC8616
FGC8617
FGC8618
FGC8619
FGC8620
FGC8623
FGC8626
FGC8627
FGC8629
FGC8630
FGC8631
FGC8632
FGC8635
FGC8639
FGC8640
FGC8641
FGC8642
FGC8644
FGC8645
FGC8650
FGC8651
FGC8653
FGC8654
FGC8656
FGC8657
FGC8658
FGC8660
6973755-T-G
7031222-G-A
7531755-G-GA
7679534-A-C
9847711-A-G
15663415-C-A
16330831-G-A
17300005-CAGAT-C
17807852-C-A
17926021-T-C
18091670-C-T
18548949-G-A
19069727-C-T
19078694-G-A
19230481-G-A
21560920-C-T
21683132-G-A
21707675-A-C
22507658-G-T
22974510-A-C
23089892-C-G
2882558-A-G
21883592-T-A
17018691-T-C
Z17580?
Y2368?
Y2369?
Y2371?
Y2372?
6867687-T-G
7596723-T-C
7622464-T-G
7936691-C-T
8368558-A-G
8437961-G-A
8488569-T-G
8518901-A-T
8558965-A-G
8660119-T-C
8868975-G-T
9157557-G-A
13139113-A-G
14022302-C-T
15052090-T-C
15067149-C-T
16647788-T-C
17400077-T-A
17861633-C-T
18017343-G-A
18639465-T-TT
19118469-G-A
19198586-G-A
19284024-C-A
20630747-GTCTAC-G
22443015-T-G
22470156-G-C
22487135-T-A
22786757-A-T
22870052-T-A
Z17580?
Y2368?
Y2369?
Y2371?
Y2372?
Z18014
Z18015
Z18016
Z18017
Z18018
Z18019
Z18020
Z18021
Z18022
Z18023
Z18024
Z18025
Z18026
Z18027
Z18028
Z18029
Z17470
Z18030
Z18031
Z18032
Z18033
Z18034
Z18035
Z18036
Z18037
6661870-C-T
13649302-T-A
18063556-G-A
19181696-A-C
21481499-A-G
15800452-A-G
16440667-T-C
17189680-GGT-G
17340702-G-C
17684921-T-G
17762525-A-G
17841513-C-A
18104869-C-T
21089641-G-A
21359676-T-G
21869485-C-T
22471975-G-T
22486674-T-C
MC21
Z17580?
Y2368?
Y2369?
Y2371?
Y2372?
2870801-T-C
6805357-A-G
7649443-C-T
7655993-T-G
8256493-C-G
8605441-C-T
14126986-C-T
14187382-C-T
14770203-C-A
14981433-A-T
15010515-A-G
M2036
15896826-C-T
16484027-T-C
19261815-T-C
19920216-G-GC
21643927-C-T
22423557-A-G
22717760-T-G
23020761-CAGTT-C
23743592-G-A
28769781-G-T
6426023-G-A
7526021-G-A
8022993-C-A
8023788-AC-A
8087318-A-G
8481753-A-T
8980284-G-A
9092440-C-A
9392611-G-A
9476512-T-C
10060320-C-T
13310485-G-A
13715335-G-T
14140175-C-T
14630283-G-T
14809238-A-G
14843965-C-A
15146137-A-C
15319973-CTT-C
15846469-C-T
16134334-A-T
16186854-A-G
16197094-C-A
17459473-T-C
18215961-G-A
19153216-T-A
19444615-C-T
21143319-A-G
21360130-A-C
21564257-A-G
22242029-T-C
22465274-C-T
22467331-T-A
22733838-C-G
23449600-C-A
Z17580?
Y2368?
Y2369?
Y2371?
Y2372?
FGC14676
FGC14683
FGC14692
M8963
7527754-A-C
7724647-A-G
8020513-G-A
13805930-T-C
13823707-G-C
13829601-A-T
14546953-G-T
15902700-AT-A
15949589-A-G
17506468-C-A
17613741-G-A
CTS9784
19121482-C-T
20819574-G-C
22483719-T-A
23606650-T-A
24426132-T-A
24431047-A-T
25095146-G-A
L563
FGC14672
FGC14673
FGC14674
FGC14675
FGC14678
FGC14679
FGC14680
FGC14681
FGC14682
FGC14684
FGC14687
FGC14689
FGC14690
FGC14691
FGC14693
FGC14694
FGC14695
FGC14696
FGC14697
FGC14698
FGC14699
22446018-G-T
22457392-G-T
FGC14700
FGC14701
24080181-C-A
FGC14702
DF49 S474
Z2980 S6154
Z2983 S6146 S475
S476 Z2976
DF23 S193
Z2985 S7068
Z2986 S6137
Z2961
Y2599
S642 Z2974
Z2956
Z2962
Z2963
Z2964
S6155 Z2965
S637 Z2970
Z2971
M222 PAGES00084
S641 Z2973
S645 Z2977
Z2984
S651 Z2988
S6152 Z2990
S6141 Z2991
Y2601
Z2969
S652 Z2989
S6149 Y2602
S7815
FGC449 Y2596
FGC462 S7073
S635 Z2968
S640 Z2972
Z16322
Z2966
M11666 CTS11001
Z2975
S656 Z2959
S653 Z2955
Z2960
Z16323
2793166-GATT-G
S655 Z2992
Z2958
M2626 S629
Y2597
FGC7512
FGC435
Y2600
S634 Z2967
Z2982
Y2597?
FGC7512?
FGC435?
Y2600?
S634? Z2967?
Z2982?
DF104 S661
DF105 S659
DF106 S658
DF109 S660
DF85 S675
FGC12183
FGC12184
FGC12185
9386271-T-G
FGC12186
FGC12187
FGC12768
FGC12190
FGC12191
FGC12192
26318498-G-T
FGC12188
22480198-G-C
FGC12188?
22480198-G-C?
S673
DF97
FGC8738
13684180-G-C
S666
16225568-A-C
16698480-C-A
17471509-A-T
17480980-G-C
21118208-C-A
21758428-A-G
22246611-A-G
22458365-A-T
22485328-G-T
CTS11036
23962449-A-C
FGC19852
FGC19853
FGC19854
FGC19840
FGC19856
FGC19844
FGC8739
FGC19845
FGC19846
20000338-C-A
FGC19847
FGC19848
FGC19857
FGC19858
6912639-A-T
6912860-T-G
7995742-T-C
15690745-C-T
16766242-T-C
17489116-A-T
21300820-T-G
22445636-A-G
22476057-G-C
22751955-A-G
24398400-G-C
14460685-C-T
18149220-T-C
18855375-A-G
19367351-T-G
19489417-C-T
19551371-A-G
22201722-C-T
22725760-C-T
6701161-G-A
8009892-G-A
8048330-A-T
14001872-C-T
14404086-G-A
16482821-A-T
18760620-A-G
23965625-C-T
9389227-T-C
16927009-G-T
21990774-G-C
2834490-AATTAAG-A
8398765-T-C
9378168-G-T
CTS3543
15421505-T-C
17081785-C-T
17415433-C-T
18103031-G-GT
18163871-G-A
19395058-T-C
22461399-G-A
22519945-A-G
22728134-A-G
23162596-C-A
2753530-C-T
6149523-A-T
6738900-C-T
7556010-G-A
Z2072 FGC7985
15851246-C-CA
16388935-C-A
17128814-T-C
17242951-G-A
18693819-G-A
18714461-C-T
19216859-G-C
21327170-A-T
22440471-C-A
22478118-C-G
23089207-G-A
23480080-T-A
DF105? S659?
22471633-CT-C
FGC4133
24481701-TTCC-T
FGC4134
7986562-T-C
9469186-A-G
18267592-T-C
23389855-G-A
7031864-G-A
22469641-G-C
22469642-A-G
22469704-A-G
22469711-A-C
22470741-G-A
2744535-C-T
2828587-A-G
8090102-AG-A
9070683-C-T
22600671-C-T
22832175-G-T
FGC4108 S588
S7814
A694
2894404-A-G
7220717-C-A
7488591-G-A
14827776-C-T
15905439-A-G
18801629-C-T
22458252-G-T
23454571-A-G
23871764-G-A
6939851-T-C
7334635-G-A
7506958-C-T
7911375-A-T
8134122-C-T
8260164-T-C
13805506-G-A
14285359-T-A
14287687-A-C
14692393-A-G
14930786-G-A
15954318-G-A
16416312-T-C
17747413-G-A
17919468-A-T
18394692-G-A
18762690-G-A
19038873-C-G
19449766-G-A
22031780-G-T
7034127-A-C
8086562-C-G
8225377-G-A
8584452-C-G
9759947-T-C
13997501-A-T
15343113-A-G
15418659-C-T
16781902-T-C
17170872-A-G
18074443-C-T
18825777-T-C
21905051-C-T
22458091-G-T
22476001-T-G
22478116-T-G
22816088-C-T
22921708-G-T
22928223-T-G
22929048-T-A
6768866-G-A
7074331-C-G
9787743-A-G
13659750-C-T
14487506-G-A
15571348-A-G
15773248-T-G
17293846-A-G
22549094-T-A
FGC19860
FGC19861
FGC19862
FGC19863
FGC19864
FGC19865
FGC19866
FGC19867
FGC19868
22142951-C-CA
FGC19869
6905391-A-G
7704320-C-T
8217891-T-G
8406317-G-A
9996640-A-G
14346039-G-A
17949897-T-TA
19163346-C-G
22761024-A-G
23595739-A-G
A223
Z18599
15335669-C-T
6386757-A-G
9835095-T-C
15303636-C-T
15383619-A-G
18659397-C-T
18711077-A-C
21467172-G-A
21491558-T-A
22241998-C-T
22619163-C-G
23628486-C-T
8803731-C-T
9043531-G-A
9759570-C-T
14768954-C-T
18233546-A-T
19306373-A-C
21715380-T-C
24391771-G-A
25200937-A-G
26495295-G-C
A224
A225
4243398-A-G
7738518-C-T
Z18599
14360002-G-A
16260512-CA-C
22612395-T-C
23147369-G-A
Z18599?
21937673-T-C
22470702-G-C
23497872-C-A
24502100-T-C
26535439-G-A
A259
A260
FGC5939
Z17590
9925527-C-T
14597893-C-T
16361884-A-G
17312062-G-A
FGC8039
21643297-G-C
21738005-C-T
FGC6230
22485418-A-C
23622875-A-G
2883186-C-T
8473123-G-A
16474319-A-G
22246528-T-G
22897297-C-T
24221318-T-C
7070589-C-T
7267824-C-T
7519965-G-A
9403374-G-A
9846804-T-G
9846805-A-G
13653715-C-G
14049598-C-T
14080562-A-G
15969469-T-G
19523046-C-T
6777291-T-C
7551254-C-T
22908138-T-G
22966209-T-C
23236943-C-T
23893952-A-AA
7262695-C-T
8548843-C-T
8608935-C-T
14908045-A-T
15459916-A-T
16304272-A-G
16344301-C-T
17514501-C-T
17921703-C-T
19196196-C-T
21232775-G-A
21500089-C-T
22239211-A-G
22262988-T-A
22470401-G-A
23522806-C-T
7209674-T-G
7361930-C-T
7999006-G-GT
8877865-G-A
9866873-C-T
9905994-T-G
13849867-G-A
14659082-C-T
15430455-CTT-C
16254608-C-T
18044224-T-G
22466307-G-C
22891579-T-C
2653784-G-C
6341894-G-A
8898547-A-G
14331267-T-C
15803249-C-G
16281984-T-TT
18100701-C-A
23235262-C-A
24439185-C-T
26544646-T-A
3016198-A-T
6823753-T-C
8465174-G-C
8982365-G-GT
13716905-A-T
15114538-TTA-T
16249123-T-C
19295092-G-C
21870366-T-C
23121366-A-T
DF105? S659?
7046140-C-T
7144516-C-A
7152158-A-T
Z12228
8360365-T-G
8776883-T-A
9023068-G-A
9844388-C-T
15311209-C-G
15578640-A-G
17354698-G-A
19004816-A-G
21133874-T-C
21521063-T-C
22246444-G-A
22589053-T-G
23652649-G-A
7772459-G-A
7903484-G-A
14482774-G-A
16391411-A-T
17171639-G-T
21397988-T-C
21817581-A-C
22229815-C-G
22569588-A-C
M2626? S629?
FGC440
FGC441
FGC442
FGC443
FGC444
FGC445
FGC446
FGC447
FGC448
FGC450
S568
FGC452
S566
FGC454
FGC455
FGC456
FGC457
FGC458
FGC459
FGC460
FGC461
FGC463
M2626? S629?
S640? Z2972?
2653099-GA-G
7193542-A-G
7681614-G-A
8744454-G-A
15028075-GTATTT-G
15603749-T-C
16841620-C-T
17410177-C-T
17445313-G-A
21591844-G-A
27320576-A-T
FGC4077
FGC4078
FGC4087
FGC12948
FGC12936
FGC12951
FGC12938
FGC12940
FGC12942
FGC12943
FGC12944
FGC12945
FGC12946
FGC12947
FGC12949
FGC12950
FGC12937
FGC12939
FGC12941
8484958-G-C
9051612-A-G
9505835-A-G
9906054-C-T
S952
14054772-G-A
14891607-C-A
18238459-T-C
18554800-T-C
19475712-T-C
19504534-C-T
21972025-A-G
23796036-G-T
23806474-C-T
28711229-T-A
2747791-A-G
3161278-C-CA
6362412-C-T
6695223-G-A
7421899-C-A
8576561-A-G
8756371-A-C
9122602-A-T
14094212-G-A
14977707-T-C
16020293-G-T
16811788-C-T
17409683-C-T
17877064-T-C
17878871-C-G
18385043-T-A
18748146-G-A
19012050-A-G
19057102-CT-C
22442273-G-T
22469034-C-T
22483798-T-C
22540165-C-A
23130599-A-G
24364224-T-A
6653239-G-T
7270607-C-A
8355187-GA-G
8852355-C-T
9000392-C-A
9862029-G-A
15029429-C-T
15516993-A-G
18667929-T-TC
22480458-G-T
22616932-A-C
23568633-G-A
2724421-G-T
A363
A364
A365
A357
A358
A359
A360
A361
M4491
A320
A362
7606032-T-C
7655903-G-A
14919053-ATTC-A
15314763-G-T
15624609-A-T
15843318-C-G
16275078-C-T
18259658-A-C
19067120-C-T
21801905-G-A
22185714-C-T
23456825-T-A
23590733-T-G
28770011-C-A
Z17591
Z17592
Z17593
Z17594
Z17595
Z17596
Z17597
Z17598
Z17599
Z17600
Z17601
Z17602
Z17603
Z17604
Z17605
Z17606
Z17607
Z17608
Z17609
Z17610
6253353-A-G
6892950-C-T
8506447-G-T
8513799-C-A
M11168
14412685-G-A
14851706-A-G
15504753-T-G
18051947-C-A
23410035-T-A
5690607-A-G
7790072-A-G
8675792-G-A
13703499-A-G
14148108-A-T
15230694-C-T
16452565-A-C
19020340-C-G
19172090-T-A
19227409-G-A
21516761-G-A
21872872-T-C
FGC6540
FGC6564
FGC6562
FGC6546
FGC6547
FGC6548
FGC6549
FGC6550
FGC6559
FGC6560
FGC6561
FGC6563
FGC6565
FGC6566
FGC6567
FGC6568
FGC6570
FGC6571
FGC6572
FGC6541
FGC6573
FGC6574
FGC6575
FGC6576
FGC6577
FGC6579
FGC6580
FGC6581
FGC6582
FGC6583
FGC6584
FGC6585
FGC6542
FGC6543
FGC6544
FGC6545
FGC6539
FGC6587
FGC6551
FGC6552
FGC6553
FGC6554
FGC6555
FGC6556
FGC6557
FGC6558
FGC6569
FGC6578
FGC6586
6513615-T-A
7642672-C-G
8280170-A-AT
8288027-T-A
8428788-A-C
8553722-G-A
9095850-C-G
9102995-G-A
9152284-A-G
9953776-T-C
13647562-G-A
14369978-G-A
18732908-C-T
18807716-A-G
21399468-CTG-C
21734770-AT-A
22026776-A-C
Z15158
22472849-T-C
22565718-A-G
22594753-T-C
22675101-T-C
22716989-A-G
6893828-CT-C
6893834-C-A
6949907-A-G
7354220-T-G
7829918-C-G
8012861-C-G
8138930-C-T
8892495-G-A
14276308-C-T
14975183-G-T
15152076-T-C
15801166-T-A
16232762-C-G
16830187-T-C
17491113-A-G
17568885-G-A
18063418-A-G
18114360-A-G
18924424-A-C
19800074-A-G
21064874-TA-T
21098374-G-T
21432918-C-T
21618477-G-C
21736328-A-G
21757244-A-G
22439187-C-T
23279638-G-A
23748686-T-G
24006637-G-C
24394639-C-G
24874216-A-G
2794251-T-C
2798943-T-C
2865447-G-C
8253909-C-G
8334321-T-A
8470287-T-A
9121078-A-G
9463227-G-C
9873032-G-C
14424538-C-T
16340919-A-T
16841094-C-T
16962201-G-C
Y708
17905141-C-T
18671466-A-C
19132675-C-T
21800153-T-C
22235916-C-T
22462312-G-T
22610306-G-C
22730251-G-A
22859295-G-C
22871158-TC-T
23257711-C-G
23347268-T-A
23819647-AGCTGTGACT-A
23842752-C-T
CTS1199 PF1521
PF3871 CTS6265
17881230-C-G
18720028-T-C
CTS11075
5060608-T-C
6851826-C-T
7459492-C-T
8048913-A-G
8120933-C-T
9062283-G-A
13988116-C-A
14140520-C-T
14202294-C-T
14409633-G-T
14536027-A-G
16690460-C-T
17383393-C-A
17947295-A-G
17975988-T-C
17986394-C-A
18037770-A-T
18634516-A-C
19150794-G-A
21429145-T-C
21481634-T-C
21654584-T-C
21844998-T-C
22464462-G-T
22489395-G-T
22625389-G-C
22717122-T-C
22741308-A-G
22935671-A-G
23729859-C-T
8181106-CT-C
8465764-G-C
8703077-C-T
9405796-T-G
CTS1809
14197054-C-G
14426306-C-A
14629530-A-G
14826291-T-C
15749843-A-AA
15776556-C-T
16087114-G-C
16569155-T-A
16793539-T-G
16957414-A-T
17017961-C-T
17064176-G-A
17135093-C-A
17359892-G-A
17638073-T-G
18553537-G-A
18766524-T-A
19009887-G-T
22478549-G-T
22590051-C-T
22712058-T-C
22720673-A-AA
23852092-A-G
24520136-C-T
FGC9595
FGC9591
16367410-T-C
16456423-T-C
FGC9631
17079776-AG-A
17358691-GTC-G
17807641-C-A
19109590-A-C
FGC9635
6154481-A-G
6801766-T-C
8109592-G-C
8210611-AC-A
9393231-A-G
L277 S334
13675577-AG-A
16455153-A-G
CTS5939
16910836-A-T
17679647-C-A
19165998-T-A
19524034-G-A
19529505-G-A
21732450-C-G
22440791-C-T
23135573-G-C
6763646-A-T
7557638-G-A
7698204-G-C
8153260-T-C
8543569-A-C
14978265-T-C
15704504-T-C
17102451-T-C
19372081-C-A
21126029-A-G
22445316-C-G
22445801-T-A
22447856-A-C
22484246-T-G
23023909-A-G
23240444-G-T
23754131-A-G
24651565-C-T
28621033-C-G
2814451-T-C
6789122-A-T
8039324-A-G
8803948-G-A
13849415-C-T
14335481-T-G
14706480-C-T
14803688-A-T
15086832-G-C
15552783-T-C
15716673-T-C
16368089-AC-A
16692557-G-A
16923644-C-T
17140765-C-A
17344045-A-G
17509871-A-G
17834010-C-T
17976770-A-T
18925720-G-A
19118141-T-C
19240494-A-G
19503729-T-C
21073744-T-C
21174348-C-T
21188707-T-G
21391961-G-T
22061571-G-A
22159402-G-A
22269789-G-C
22651996-C-T
23139056-C-A
23139997-A-T
23254724-C-A
23859580-T-C
FGC11210
2860915-C-T
6870063-T-G
6896791-C-T
7094002-G-A
9170818-G-A
9778041-T-C
9788762-G-A
14082301-A-T
14481002-G-A
14481004-C-T
14699465-C-G
15447523-G-A
15753887-G-A
15792117-C-A
16630246-A-G
17603537-C-G
17606090-T-C
17816097-A-T
17986251-T-C
18590837-G-T
20066584-T-C
21682974-TC-T
21808761-T-A
22103169-G-A
22478958-G-C
22617588-T-G
22907081-C-T
23079590-C-T
23330057-G-T
23371903-A-G
23615807-T-C
FGC11163
3721020-G-A
4875054-T-C
7935412-A-T
8153085-T-A
8458494-C-T
8489617-CA-C
8657436-G-A
13678251-G-A
14232788-T-C
F1764
15822779-A-G
16589560-T-G
Y55
CTS6458
17661760-C-T
17720879-TT-T
17996040-T-A
18051079-A-G
18584934-T-G
18678186-T-C
18680929-A-G
18788113-A-T
18836081-C-A
19189345-C-T
21034540-C-A
21143584-G-C
21485887-T-C
21561887-G-T
22184146-T-C
22294088-T-A
22461195-T-C
22740292-A-G
22886921-C-T
23041893-C-T
23433960-A-G
23514582-CT-C
FGC11203
2829624-G-A
6959338-C-A
7165452-C-G
M3473
8272480-TGGTGTTCA-T
8374790-G-T
8568438-G-T
FGC15534
9418832-A-G
13669940-C-T
14246249-T-C
14253551-T-A
14295977-G-A
14309881-G-A
14334032-C-T
15312309-C-G
15407775-G-C
16524258-A-C
16788850-C-A
16903925-A-C
17299772-A-C
17974824-C-T
18118381-C-G
19004842-C-T
21081323-C-T
22082123-A-G
22087970-G-A
23189764-G-A
23654340-G-T
24399592-C-A
FGC11165
FGC11161
FGC11177
15779280-A-G
15902572-T-C
FGC11189
FGC11190
FGC11191
FGC11193
FGC11195
FGC11197
FGC11199
17654167-A-C
FGC11200
FGC11201
19231702-C-A
19239570-G-A
20803281-A-G
21464952-GTTC-G
FGC11205
FGC11206
L302 S464
22942331-T-C
FGC11209
23538567-A-T
Z18038
Z18039
Z18040
Z18041
Z18042
Z18043
Z18044
Z18045
Z18046
Z18047
Z18048
Z18049
Z18050
Z18051
Z18052
Z18053
Z18054
Z18055
Z18056
Z18057
Z18055?
4353515-A-G
6675801-T-G
7180960-A-C
7274400-A-G
7386115-A-G
7665538-A-G
8976332-A-G
9861612-G-A
13503673-G-C
15622788-T-A
17303139-T-C
21993134-C-T
22470051-G-A
22471850-G-C
22476947-G-A
22477020-A-T
23403309-T-C
23535408-C-T
23885727-T-A
Z18057?
7034971-A-G
7972727-T-G
Z18056
13661469-G-T
14069545-G-A
14839642-G-C
15123358-T-C
16133761-G-C
18852206-A-G
21185388-G-C
22470994-C-T
23984540-A-G
FGC7991
3409379-G-A
6398542-A-C
7435582-C-T
7741528-C-G
7752668-C-T
7962393-T-G
8230764-G-C
8515027-G-A
8675294-C-G
8973806-G-A
9136432-A-G
14596869-G-A
15582866-G-A
16284427-A-G
17527534-T-C
17908565-A-T
17921488-A-T
18094923-T-C
18719543-G-A
19078781-C-G
19093880-G-A
19187912-C-T
19321845-G-A
21147365-C-G
PR3654
21978184-G-A
22117506-A-C
22256485-A-T
22458689-G-A
22487128-G-A
22665342-G-A
22830854-T-C
23044794-G-T
24451439-T-C
13691554-G-A
22473950-G-T
14614339-A-G
22473950-G-T?
8230764-G-C?
17908565-A-T?
19093880-G-A?
7435582-C-T?
7752668-C-T?
14596869-G-A?
F1404
14379602-C-G
2793390-T-G
14751709-C-T
16711633-A-G
22246251-G-T
22246261-A-C
22246264-T-C
22246265-A-T
22246349-T-C
23985133-T-C
S730
S737
PT1
S747
L1335 S530
S5285
S5284
S5264
S5257
S5280
S745
S733
CTS6838
CTS10008
S742
S743
CTS11722 L1065 S749
PT2
CTS7030 S735
CTS10351
S750
S731
CTS3057
S736
S715 S5259
S5271
S5274
S5266
S5263
S5291
M10953 S738
S739
Z16324
FGC9558
FGC9560
S709
S744
Z16325
S764
S7370
L743
Z16326
FGC18199
FGC18200
PR5563
FGC18201
FGC18202
15879765-C-T
17366661-G-A
18161664-T-C
22571307-C-A
28229336-A-C
2827937-C-T
FGC18198
9789357-A-T
8375773-GC-G
6414910-G-A
Z17611
Z17613
Z17612
FGC17603
FGC17598
FGC17599
FGC17600
8770009-C-A
FGC17601
13805830-TAGAA-T
FGC17604
19472571-C-A
24444622-T-C
FGC17606
FGC17602
FGC19782
FGC19785
FGC19784
22559001-C-A
FGC19786
FGC20020
FGC20022
7789427-C-A
14004107-C-A
15562303-A-C
18195204-C-G
22459806-A-T
13657663-G-C
14414598-G-A
14612408-C-G
3074265-G-C
14275871-G-A
14528581-A-T
PR1747
17659798-G-A
18204012-C-A
18920789-A-G
19076670-C-A
19342160-T-C
22030799-A-G
22115645-CAG-C
23258938-C-T
23771188-A-G
9761419-A-G
13497952-T-C
14504198-G-A
16218272-A-G
17711569-C-T
18829129-G-A
21959521-C-A
22258078-C-G
22270079-G-A
23864294-T-C
16494398-G-T
21303350-G-A
23233303-C-A
18841393-G-A
22683707-A-G
S756
Z16327
Z16328
A33
A34
A35
17686661-T-C
A37
13819563-G-GA
18788814-AC-A
13799338-C-G
A30
8644551-A-C
6795472-A-G?
22699108-T-A?
6795472-A-G?
22699108-T-A
A30?
22699108-T-A?
6795472-A-G
9523684-T-C
17919985-A-G
14281409-A-C
17820027-TG-T
15471973-T-C
16305913-A-T
20826047-T-C
21842029-T-C
24879274-G-A
18396484-T-A
FGC17058
9754793-G-T
M3966
9850337-G-C
19045736-C-T
19046648-G-C
Z17614
17080428-G-T
22568476-C-A
23525329-G-A
6659635-G-C
7804711-A-T
7939601-T-C
9832817-C-A
16869264-TTTTCAGGAATGCTT-T
16869279-TC-T
16967951-T-TT
FGC925
8547964-C-T
S3853
15641925-G-GT
17490651-A-G
18943335-C-A
18943337-A-C
21835556-T-C
22936338-C-T
2866874-TG-T
2866880-GA-G
2866886-A-G
FGC18441
FGC18447
18566177-ATAT-A
7989911-A-G
Z300 F1314
13827362-T-C
14698962-G-C
16507359-GC-G
16741294-C-T
17762778-A-G
19156499-G-A
19162679-G-A
2866874-TG-T?
2866880-GA-G?
L141 FGC274
FGC18442
FGC18443
FGC18445
FGC18446
FGC18449
FGC18453
FGC18450
FGC18451
FGC18454
!M11829
FGC18452
FGC18444
FGC18448
S7367
7229801-A-G
8750014-G-A
9013591-G-T
9759717-T-C
17959088-C-T
18837326-C-T
19005273-T-C
6720104-AT-A
7569510-GAT-G
PF5721
14824777-A-G
14841515-A-C
15554541-T-A
15650155-C-G
15852328-C-T
CTS4931
16298330-C-A
17747503-G-A
17747507-T-A
18669241-C-T
19046370-A-G
21608109-A-G
23553402-T-C
23820731-C-A
23820744-T-A
8241884-A-C
8464497-C-T
9003515-C-T
17765676-T-G
17889971-C-A
17963288-T-G
22445725-AC-A
22567572-A-G
2697143-A-G
2726925-T-C
F144
17321343-C-T
17510836-T-A
17526497-T-G
20803718-T-C
23117962-A-G
23577085-T-A
13685652-A-T
13887704-G-A
14778242-C-T
16746391-T-A
17323309-G-A
21858530-T-C
22480509-G-T
24125405-C-T
28772348-C-A
Z17615
PF5236
Z17616
Z17617
Z17618
3078804-A-G
6841773-G-A
14399771-A-C
18256617-C-CG
22106300-T-C
28778784-C-G
15346695-GC-G
2885379-T-C
7278370-G-C
21533704-C-T
8620385-T-G
17353403-A-G
17607110-G-C
22094391-A-G
23575958-C-A
S691 Z13851
S27554
S1256
S1257
S1258
S1259
S1260
S4126 S4611
S4183 S4067
S4585 S4636
S4799 S4806 S4983
S26584
7763827-G-C
7808000-G-A
8702341-G-A
8823363-T-C
14168426-AT-A
18787960-G-A
19557678-A-G
22473424-C-G
23575945-G-T
FGC19437
9877957-T-C
4443701-G-T
21945532-CG-C
21945532-CG-C?
9877957-T-C?
FGC19437?
8616777-C-A
17716101-C-A
9877957-T-C?
21945532-CG-C
CTS10860
15704838-A-AT
9877957-T-C?
8046318-G-T
9877957-T-C?
4443701-G-T?
21690947-G-A
23881858-T-C
23881876-CAAA-C
23881885-A-C
23881887-A-C
23969377-G-T
4443701-G-T?
CTS4554
18145787-C-T
22118355-A-G
S690
S697
S701
S703
S27834
S27835
FGC17830
FGC17833
FGC17834
FGC17835
FGC17836
FGC17837
7400572-G-C
7546070-G-A
M844
19419156-A-T
20770245-G-C
7212182-A-G
7378208-T-C
8123355-T-C
8346366-AT-A
8656614-A-T
14355657-C-T
14873810-A-G
15572916-T-C
17578274-G-A
17897796-G-C
22526606-G-A
23893765-A-G
FGC9566
10007261-CGTCCGTGTGT-C
FGC9569
17277520-CAT-C
FGC9561
FGC9571
FGC9572
FGC9573
FGC19633
FGC19635
FGC19636
FGC19638
FGC19640
21314349-G-A
FGC19641
FGC19642
FGC19643
FGC9558?
FGC9560?
S709?
Z16329
Z16330
Z16331
Z17619
Z17620
18776934-G-A
6931804-C-T
13651802-A-G
17091555-A-T
18105464-C-T
21454233-C-T
22239308-C-T
7715261-C-T
17682290-C-T
18023825-G-T
Z18058
CTS1007
8082338-G-A
15165475-T-C
19038257-C-T
22463221-G-T
8396304-A-G
18145216-A-G
19207142-C-T
CTS10118
21516005-G-A
22216341-T-C
22938038-A-C
8211740-A-C
8486054-A-G
15331072-T-C
17959178-G-GA
18137157-C-A
23598958-G-C
FGC10125
2838686-A-T
6953311-A-G
7600044-G-C
9416375-C-T
9464905-C-T
14970486-G-C
16874162-T-C
19068094-T-A
21728179-CATAT-C
21938017-T-A
22258140-C-A
22440333-G-T
23002643-C-T
7875451-G-T
8526130-G-A
8592248-T-C
9845309-CAT-C
14277218-A-C
15464205-T-C
15602933-T-G
15933336-A-G
17445272-C-A
21844187-C-T
22457953-C-T
22469783-G-C
22471179-C-A
FGC10117
FGC10121
FGC10124
FGC9558
FGC9560
FGC10113
FGC10114
FGC10115
FGC10116
FGC10118
FGC10119
FGC10120
FGC10122
FGC10123
FGC10126
FGC10127
FGC10128
FGC10129
FGC10130
FGC10131
2739858-A-G
2887969-A-G
6800232-T-C
17982691-C-T
18044877-A-C
21882007-A-C
22583191-A-G
FGC9558?
FGC9560?
S709?
16132246-C-T
16863494-A-G
18128601-G-T
18241246-C-T
19103894-G-T
19151723-C-T
19563870-T-C
23570818-A-C
FGC9558?
FGC9560?
S709?
13735388-G-T
15569952-G-C
15778719-C-T
17329002-C-A
21814872-T-C
23193485-T-G
2822580-T-A
6894608-C-T
FGC15565
8215964-T-C
14359203-G-C
14770512-T-G
15222954-C-A
16731424-G-A
16899711-T-A
17601986-C-T
19218589-A-C
19305376-G-C
21158536-C-CAGAT
21479605-T-C
22270223-G-T
22472119-G-A
22484172-C-T
22607547-G-C
24481453-CA-C
24891135-A-G
7750789-A-G
19452511-G-A
6932264-G-C
14078697-G-A
16512393-C-A
19215179-G-T
L371 S300
FGC10050
FGC14575
FGC10053
FGC10055
9112193-C-T
FGC10057
FGC14576
FGC14577
FGC10059
FGC14578
FGC10063
FGC10064
FGC14580
17365445-AG-A
FGC14581
FGC10067
M11461
FGC10069
18040339-GT-G
FGC10072
FGC10074
21929641-G-A
FGC10075
FGC14582
FGC10077
22471946-A-G
FGC10078
FGC14583
FGC10085
DF1 L513 S215
CTS5396 S5196
S5197
S5191
S469
S5194
S5668
A2
FGC9776
A7
L193 193.1 S176
A4
A5
A6
S7123
S5990
Z16332
S5979
S5982
Z16333
FGC9816
S5992
Z17621
Z17622
Z17623
A3
A8
A9
6853551-A-C
8181868-T-C
8365807-G-A
8639968-CAG-C
9458480-T-C
13665737-T-C
14137188-C-A
14246531-T-A
17897211-T-C
18220772-G-A
19365146-G-A
22229212-T-C
22893841-T-C
M5365
8076512-G-A
14276582-T-A
14415926-C-G
15608770-C-T
16602005-A-C
16603734-A-T
19179406-C-T
21234216-A-G
22187799-G-A
22473748-C-T
22513681-C-T
24005002-C-T
24516135-C-T
26707383-C-T
Z17295
Z17296
Z17297
Z17298
Z17299
Z17301
Z17294
Z17302
Z17303
7361894-T-C
7840005-A-C
8459160-G-C
14587603-A-G
7617915-G-C
7641225-T-C
8838688-G-A
9415833-A-G
14301542-A-G
14969088-G-C
17462884-G-T
17531167-C-G
18900617-G-A
21423123-C-A
22040342-T-C
8640935-C-T
22459226-G-T
22785075-G-T
7474215-G-A
21610974-C-A
22706252-G-A
24368971-G-A
Z18059
Z18060
Z18061
Z18062
Z18063
Z18064
Z18065
Z18066
9163173-TG-T
9647182-C-T
15566239-G-A
22256524-G-A
28786320-C-G
6634643-C-T
16730591-G-A
19246258-C-T
21658073-C-G
Z17813
Z17814
Z18067
Z17815
Z17816
7823935-C-T
7842991-G-T
8444479-G-A
8475004-C-T
9850416-C-T
Y294 M3496
Y295 M3497
15138460-G-C
15159871-A-T
16775937-T-A
17558610-A-T
23955434-A-G
Z17623?
14338133-T-C
CTS9485
19179614-T-C
19221469-G-A
P46
22181494-C-T
22464480-A-G
23640287-G-A
Z17817
7137304-T-G
7856376-A-C
8069849-G-C
8192573-T-C
Z14829
14200713-C-G
14949834-T-C
16186692-CA-C
16631212-TCCA-T
16900110-C-T
17345060-C-T
17498330-G-A
17946500-T-C
18705079-G-T
21255841-C-A
21331740-C-T
21810637-A-G
22478317-A-C
22909944-G-C
23956617-C-T
6389470-G-A
8339559-C-T
14018412-G-A
14597367-C-A
14774632-A-C
14974695-A-G
15260211-C-T
PF7379
16523203-C-T
17821354-T-C
18050176-G-A
18071096-C-A
18245800-T-C
19161547-T-C
21300539-C-A
22176414-A-G
23114928-T-C
3284882-T-C
7831343-G-T
16448970-G-A
18182269-G-A
18966731-T-C
21062169-G-T
21088037-G-A
22263191-T-G
22437230-C-T
22478350-T-A
Z17623?
7386657-G-A
9114746-C-T
9843195-A-C
9904179-C-CT
9905863-C-G
9906062-G-T
14787522-C-A
15738296-G-C
15816866-C-A
15979719-C-T
16238892-C-T
16369547-C-A
16756170-G-A
17811361-C-A
18545500-T-A
19124739-A-G
19316239-T-C
21923473-C-G
22470393-G-A
2907787-A-T
6679302-G-A
14235039-G-A
15996977-T-C
16786246-A-G
17045341-G-A
17514329-C-T
18415158-A-G
21879607-T-C
21936960-C-T
22138443-A-T
22483590-G-A
23322648-T-C
ZS4576
ZS4577
ZS4578
ZS4579
ZS4580
ZS4581
ZS4582
ZS4583
ZS4584
ZS4585
ZS4586
ZS4587
ZS4588
13682379-ATGGAATGGACTAGAATGGACTGGACTGGAG-A,ATGGAATGGACTCGAATGGACTGGACTGGAG
8398998-C-G
6989418-T-G
15812328-G-C
16036382-T-C
16669217-A-G
19314765-GTGATGGTCTCGATCTACTGACCT-G
19472933-G-T
21637120-G-C
21777335-G-A
24451944-G-T
FGC13494
FGC13496
Z17821
FGC13498
FGC13503
Z18068
FGC13504
FGC13505
FGC13511
Z18069
22289232-T-C
FGC13508
22289232-T-C?
FGC13495
FGC13497
8650096-GAAAA-G
15657277-TATAAA-T
16439782-C-T
17819185-AG-A
FGC13500
FGC13501
FGC13502
23258141-CA-C
FGC13506
Z18489
Z18491
Z18493
Z18490
Z18492
9489954-A-C
9496654-C-T
17492965-G-T
19022160-A-G
19087733-T-A
21815668-T-A
22245972-T-A
22563132-C-T
23562371-T-A
8991165-G-T
15034104-T-C
16544099-A-T
8684447-A-C
16187336-G-A
21655225-A-G
8369435-G-A
8664001-G-C
9806733-TTA-T
15764938-T-A
17845684-G-A
18732190-C-T
18870978-T-C
18872154-CTTTT-C
20813475-G-C
22066611-T-C
22203192-T-A
22463765-G-A
23999144-C-T
Z18070
Z17826
Z17827
Z17828
Z17829
Z18071
Z17830
Z17831
Z18072
Z17832
Z17833
Z17834
Z17835
Z17836
Z17837
Z17838
Z17839
Z17840
Z17841
Z17842
Z17843
Z17844
Z18073
Z17845
Z17846
Z17847
Z18074
Z17848
Z18075
Z17849
Z17850
Z17851
Z18076
Z18077
6764678-ATC-A
14378545-A-C
18552957-G-A
21461607-A-T
22551487-C-T
6753253-A-G
7850905-A-G
13998674-C-T
14116392-G-A
15612899-T-C
17959483-A-G
19393407-C-A
24391022-TACTTG-T
8209128-G-A
14323108-C-T
14595400-C-A
S7834
S7828
M8092
17583154-A-C
17873097-C-T
18814328-C-T
19390192-A-G
S7835
21399858-C-T
21592910-G-T
22256371-G-A
22539577-CT-C
S7826
23617421-A-G
23617943-T-C
14880532-C-T
14912681-C-T
19113010-G-T
22240990-T-G
7198104-C-T
8385935-G-A
19317888-C-T
22477107-C-T
22894261-A-G
23612226-T-C
8647904-A-G
13225085-G-C
19380384-A-G
21765030-T-G
L577
23359407-G-A
15506940-CT-C
17604061-TCC-T
18578614-C-G
18807439-G-T
18812013-T-C
24409376-G-A
F903
7570822-C-G
14005779-A-G
CTS2730
CTS7085
CTS7659
19163185-A-AT
FGC9776?
6670266-T-TA
6677954-C-A
7171022-G-A
7661186-C-G
7849187-T-G
8390717-G-A
9122851-G-C
9139392-GA-G
9892213-C-T
14612065-A-G
14751128-T-A
15306803-TA-T
15610471-C-A
16691236-G-A
17118989-A-C
17420330-TA-T
17601373-A-G
19308996-T-G
21301339-C-T
21750485-A-G
21881037-C-T
22241089-A-T
22458744-T-C
22468657-G-A
22792774-T-C
23461985-C-T
28649517-A-C
FGC9795
FGC9807
FGC9794
FGC9777
FGC9773
FGC9798
Z16341
FGC9811
FGC9793
FGC9810
FGC9780
FGC9784
FGC9803
Z16338
FGC9786
Z16335
Z16336
FGC9816
Z16340
Z16342
FGC9788
FGC9804
FGC9822
FGC9809
FGC9800
FGC9775
Z16334
FGC9778
Z16337
Z16339
17003452-C-T
22174008-C-T
22362206-G-T
22472108-A-G
22474046-C-A
FGC9787
FGC9796
FGC9805
FGC9813
FGC9799
FGC9791
FGC9779
S5193
FGC9782
FGC9814
FGC9815
FGC9801
FGC9817
FGC9789
FGC9802
FGC9783
FGC9774
FGC9781
FGC9818
FGC9819
FGC9812
FGC9806
FGC9792
FGC9825
FGC9820
FGC9821
FGC7749
7996768-A-G
13816973-C-T
14341005-G-A
22686494-A-G
22724547-C-T
6876662-A-G
8067999-ACT-A
9848155-T-C
15784709-G-T
19068295-G-A
21529518-G-A
22490378-G-C
23984626-C-T
FGC9816?
6397456-G-A
7010267-C-A
15552051-C-T
17320818-A-T
19242916-T-G
21731089-A-T
22477081-C-A
22552976-G-A
23572676-C-T
FGC9788?
FGC9798?
FGC9816?
Z16342?
Z20655
14591050-A-C
15088768-C-G
16971071-G-C
17872533-G-T
17880341-C-T
17896494-G-C
Z20656
21319182-C-T
22447818-T-C
Z20657
22466237-C-T
22485356-G-A
ZS347
ZS348
2652637-G-A
15426064-G-A
22460984-A-T
14852779-T-A
15140735-T-C
15204687-G-A
FGC9776?
Z16343
Z16344
Z16345
Z16346
Z16347
Z16348
Z16349
Z16350
Z16351
Z16352
Z16353
Z16354
Z16355
Z16356
Z16357
Z16358
Z16359
Z16360
Z16853
Z18078
Z16856
Z16854
Z16855
Z16857
Z16858
Z16859
Z16860
9496274-C-A
14811391-A-ACC
14811392-G-T
18770840-C-T
22458111-A-G
Z8908
ZS350
ZS351
ZS352
ZS353
ZS354
ZS355
ZS356
ZS357
ZS358
7572358-G-A
14551388-G-A
17865028-T-C
22446004-T-A
23544443-A-G
5864202-T-C
8494132-TTC-T
13675601-C-A
13675783-G-C
15183633-C-G
21190099-T-C
21190104-A-G
Z17911
Z17912
7660872-ACT-A
9106083-T-A
14323991-T-C
CTS3563
15968916-T-C
17944589-A-G
18203498-C-T
18404468-TTA-T
S21624
19158743-A-G
21133020-C-A
22157536-C-A
23325357-A-T
2887987-C-G
14411632-G-C
17615949-C-G
19139068-A-AT
19337502-C-A
21390000-G-A
22293962-C-T
22472360-G-T
22475731-T-A
S6365
Z16361
CTS750 S8129
Z16362
Z16363
Z16364
Z16365
Z16366
CTS3087
Z16367
Z16368
Z16369
Z16370
Z16371
Z17625
ZZ18
ZZ17
Z17626
Z17628
Z17629
ZZ16
Z17624
Z17627
Z17630
Z17631
8591219-A-G
18418595-A-G
19136426-T-C
21210603-C-A
21328489-A-G
23033222-G-A
23488858-A-AC
23538557-GA-G
ZZ16
ZZ18
ZZ17
2904800-T-C
8777121-G-A
14084068-T-G
14116254-G-T
15703304-G-T
16201454-A-G
17536392-G-A
17961840-G-T
20805640-A-G
21319439-T-C
21441989-A-G
Z17625?
FGC13417
FGC13418
FGC13419
FGC13422
FGC13423
22296404-A-T
FGC13424
18034589-C-A
6936984-A-T
7527908-CTG-C
7527914-GTC-G
7640268-C-T
9426165-C-T
9445685-G-A
14159098-G-A
17009013-TA-T
17105333-G-C
17138538-A-T
21252226-G-A
22272817-T-G
22893301-A-ATTCC
M1720 CTS11742
23586180-G-C
Z16372
Z16373
Z16374
Z16375
Z16376
Z16377
Z16378
Z16379
Z16380
Z16381
Z16382
Z16383
Z16384
Z17910
Z18079
Z18080
Z18081
7977986-G-C
8191287-C-T
8836743-G-T
9398760-A-G
9398766-G-A
9398768-C-G
9398769-G-A
M2775
14436914-A-G
F2338
19158330-C-A
19221046-G-T
22089215-T-C
22293956-A-G
8390545-T-G
9444055-G-A
16333106-T-C
18827931-T-C
22212180-A-C
22479137-C-G
22598103-T-A
22606813-C-A
16235915-C-T
16460167-G-A
17651202-G-T
8372889-T-C
8535001-A-G
8576276-A-T
8881655-C-T
14650725-G-C
17240663-C-A
18074892-C-T
22559226-G-A
22892493-C-T
26078973-C-T
6330994-T-C
6647107-G-A
14658608-C-T
15340188-T-G
15869583-A-G
19229534-A-G
21485499-G-A
22751565-G-A
22847622-G-A
23567153-A-G
Z17910?
8539111-C-A
8582702-C-T
13822841-T-A
14352935-C-T
14640673-G-C
16875579-G-C
17167668-G-A
18993756-G-A
19289391-G-A
19295198-C-A
22270977-G-A
23394696-T-A
Z17910?
7871844-C-T
7901422-G-A
8895179-G-T
M9063 YSC0001322
PF349
14403436-G-C
17275290-C-T
17309747-G-T
18833077-A-G
19537146-C-T
21309329-C-T
21424965-T-C
21815962-A-AT
23423363-A-G
23538413-T-C
23592292-A-G
Z16385
Z16386
Z18082
FGC11827
3161764-C-G
3161992-C-T
8395030-A-G
8541427-G-T
8614829-A-G
9056617-G-C
14193613-G-A
14221872-A-T
16458622-C-T
16949868-C-T
17691626-T-C
17704159-C-A
17896613-CT-C
18713819-G-T
21834876-T-C
21920969-C-T
22464531-T-C
22470643-G-T
22485708-G-T
22975629-G-A
23247391-C-T
23384126-C-T
Z16387
Z16388
Z16389
Z16390
Z16392
Z16393
Z16395
Z16396
Z16397
Z16399
Z16544
Z16545
Z16546
Z17632
Z16391
Z16398
Z16394
FGC11812
FGC11813
FGC11814
FGC11815
13822593-G-A
14808170-G-GT
FGC11817
FGC11818
FGC11820
21491115-A-T
FGC11822
FGC11823
FGC11824
FGC11825
Z17801
Z17802
Z17803
Z17804
Z17805
Z17806
Z17807
FGC5838
Z17809
Z17810
Z17811
Z17812
Z18083
Z18084
Z18085
Z18082?
19081008-T-C
22469831-A-C
FGC11791
7837816-C-T
14581289-C-T
21434499-G-A
23477742-G-C
Z16546?
Z16544?
Z16399?
8559984-C-T
9881995-A-C
14820579-C-T
M248
17518092-A-C
18386282-T-A
22228470-T-C
23156997-G-C
24412573-T-C
FGC57
22722580-C-T
7875439-G-A
8466878-T-A
8467816-T-C
8819353-T-C
8846069-C-T
8888301-G-A
9642064-T-A
14482888-G-A
15029264-G-T
15077233-C-T
15479453-T-C
15506800-C-G
16248852-T-C
16342963-A-G
16437051-A-G
16557456-T-C
17781145-G-A
18406364-C-T
18641042-G-T
21212571-T-C
21411457-C-T
23031476-G-A
23284456-C-T
23797945-A-G
25375676-A-G
28757633-C-T
26042042-T-A
6942898-A-T
18078970-C-A
19226176-CATAGATAGATAAATAG-C
22245806-T-A
19227610-A-G
24371636-A-G
6853769-C-T
8084274-A-G
8170144-C-G
8703727-G-C
9496384-C-T
14078176-G-C
14200654-C-A
14319311-T-C
14353425-C-T
14819429-A-C
L1333
15388606-A-C
15490821-G-A
16204253-C-T
16335919-G-A
16635294-T-C
16790526-C-T
PF7228
17337203-T-TAGAA
17792659-G-T
18803128-G-T
19067463-T-C
19107679-A-G
19396706-G-A
21905597-A-C
22036769-G-A
22100626-T-G
22672104-T-G
22737384-G-T
22815538-T-C
L705 L705.2
Z16400
Z16401
Z16402
Z16403
Z16404
CTS3573
Z16405
CTS6621
CTS6942
Z16406
CTS8890
Z16407
Z16408
Z16409
Z16410
Z16411
Z16412
Z16413
Z16414
Z16415
CTS11744
CTS11954
Z16416
Z17909
2913476-C-T
7522525-T-C
15345418-ACT-A
15696020-GT-G
17848314-T-G
19342400-C-A
22293693-C-A
22461383-G-T
23348653-A-G
23571782-C-T
23960180-C-T
ZW01
ZW02
ZW04
ZW09
13650103-T-C
14104999-C-G
CTS2134
18165379-G-A
18739947-T-A
21864162-A-T
22486733-G-T
22740008-T-G
22787552-G-T
21464786-C-G
8198491-T-C
9075702-C-T
PF1431
14937210-G-A
15306133-C-T
16213203-A-C
18110935-G-T
22440256-T-A
23742844-C-G
FGC18506
FGC18456
FGC18457
FGC18458
FGC18459
FGC18460
FGC18461
FGC18462
FGC12955
FGC18463
FGC18464
FGC18465
FGC18466
FGC18467
FGC18468
FGC18469
FGC18470
FGC18471
FGC18472
FGC18473
FGC18474
FGC18475
FGC18508
FGC18476
FGC18477
FGC18478
FGC18479
FGC18480
FGC18481
FGC18482
FGC18483
FGC18484
FGC18485
FGC18486
FGC18487
FGC18488
FGC18489
FGC18490
FGC18491
FGC18493
FGC18494
FGC18495
FGC18496
FGC18497
FGC18498
FGC18499
FGC18500
FGC18501
CTS11795
FGC18502
FGC18503
FGC18504
FGC18507
FGC18492
FGC18505
S5191?
S469?
S5194?
7049459-G-T
7587364-A-T
7741013-A-G
7978569-G-C
8152590-A-G
8437785-C-T
8514357-C-A
8569823-CA-C
8795926-G-GT
8875843-T-A
8880175-C-T
14037547-G-A
14276295-G-A
15871284-G-A
15990606-T-C
16409074-G-A
FGC16870
17686062-C-T
21825387-C-T
22272127-C-T
22478907-A-C
22755012-G-C
22815660-A-G
22844310-A-G
22930431-A-C
23369868-A-T
23503163-G-T
23514701-C-A
S5191?
S469?
S5194?
M8944
7064505-T-C
FGC13427
FGC13428
FGC13429
FGC13430
FGC13431
FGC13432
FGC13433
8808323-C-T
16831229-A-AT
FGC13437
PF5101
20824599-CTA-C
FGC13438
L764
21661482-GT-G
21816649-AT-A
22263212-A-G
22444729-A-T
22469653-G-A
FGC13439
22661545-G-A
FGC13440
22925785-G-A
FGC13441
FGC13442
24241727-A-AG
28789796-T-C
S5191?
S469?
S5194?
2836659-C-A
6938522-T-C
Z17269
7680207-A-G
7768818-T-C
8203670-G-T
8572517-G-C
8613246-A-G
8896021-A-C
9046466-T-C
15026745-A-G
15033098-AGT-A
15277519-C-T
15712099-T-A
15833160-G-A
16437747-C-T
16806584-G-C
16855716-C-T
17494066-A-G
17867888-C-T
18683461-G-C
18973540-G-A
19207137-C-T
19495730-G-T
20985047-C-A
22262750-A-C
22461473-T-A
22474705-A-G
22476854-G-A
22483426-G-A
22634142-C-T
22864864-T-C
S5191?
S469?
S5194?
2878132-G-A
2889235-G-C
L908
8101343-G-C
8331760-C-A
8498842-G-A
8889953-C-T
9200919-A-C
10020007-G-A
13720447-C-G
14049095-T-C
15926170-T-C
16539130-G-A
16666761-C-T
L909
17580344-G-A
18081122-A-C
18578964-A-C
18585389-A-G
18924428-C-G
18924438-A-T
19045334-C-T
21340972-T-A
21464780-C-G
21566518-C-A
21857287-C-T
22476946-T-G
23239860-C-G
23307713-T-C
23483633-C-T
23842276-T-C
23867333-T-C
L679
Z16861
Z16862
Z16863
Z16864
Z16865
Z16866
PF4805
Z16867
S16264
Z16868
Z16869
Z16870
FGC1967
Z16871
Z16872
Z16873
Z16874
Z16875
Z16876
S21225
Z16877
Z16878
Z16879
Z16880
Z16881
Z16882
Z16883
Z16884
Z16885
F110
13714706-G-A
23239730-C-T
14082064-T-A
14091317-C-A
14439073-G-A
15979317-A-C
16283276-TC-T
18125133-T-C
18554215-C-T
22273422-A-G
22464861-G-A
22585074-C-A
Z17300
2888917-T-G
9157567-G-A
9170934-G-T
14416554-C-A
15110329-A-G
15517749-C-A
15622133-G-A
15725400-T-G
15908656-A-T
16190244-A-G
16257667-G-T
16312660-A-G
16647546-G-A
16890470-T-C
17237361-C-A
17310161-G-C
17717497-C-A
18033567-C-G
18772958-T-C
18899942-G-T
21266499-G-A
21532578-G-A
21841759-G-A
21905889-C-T
22010871-C-G
22462482-C-G
22463800-T-C
23328532-T-C
24929800-G-A
7943616-T-C
8561128-A-C
9088128-G-T
13715825-G-C
13735360-A-T
13735362-C-G
13735388-G-C
14530239-G-C
14806344-G-A
15237006-G-A
15272251-T-C
15489897-G-GA
15867096-G-A
16292497-T-C
16873699-C-A
17852037-A-T
18399308-A-T
18850712-A-AAT
18923103-T-G
19111913-C-A
PR3038
19237822-G-A
19440645-G-A
19441209-A-C
21231340-A-G
21822829-G-A
22632050-C-T
22948500-T-C
28785807-G-A
Z16500
MC02
FGC14723
Z18086
FGC14724
FGC14725
FGC14726
FGC14727
FGC14728
FGC14729
FGC14730
FGC14731
Z18087
FGC14734
FGC14735
FGC14736
FGC14737
FGC14740
FGC14741
FGC14742
FGC14745
Z18088
Z18089
FGC14746
PR5264
17860904-G-T
FGC14732
13715231-C-A
FGC14738
19058506-G-GA
22234545-C-A
6426456-CTT-C
14216888-C-T
15053769-C-T
15735868-G-C
28789262-G-A
2888825-C-T
6861764-C-T
7680798-T-C
7811849-C-T
7892072-G-A
8393601-C-A
9163885-G-A
9899088-A-G
14876276-A-G
16496000-T-TA
17904970-C-G
17923883-T-G
18812472-C-A
19110171-C-T
19225417-G-A
19334567-C-T
20823468-G-T
21775730-T-C
21778034-C-A
22461240-A-G
22462544-G-T
22463448-G-C
22569849-A-T
22929018-C-G
22929044-G-T
22939037-G-A
23453412-T-C
23637988-T-C
24278185-A-G
CTS1530
7529871-T-C
8379040-C-T
13818997-G-A
14407359-C-G
14437313-C-A
14572154-G-C
14626829-A-G
15324714-C-T
15577094-C-A
16806303-C-G
17729561-A-T
18060651-C-T
18704485-C-T
19498425-G-A
21628814-C-T
22461727-T-A
23059222-C-A
23071644-T-C
23471707-A-G
24415720-A-T
6145179-T-C
6371618-A-T
6780903-G-T
6798432-A-C
7514234-G-A
7927743-T-C
8484335-T-C
8756756-G-T
8757318-G-T
14079133-C-G
14085101-C-G
14085194-A-C
14103459-A-T
14226937-G-A
14393937-G-A
15565153-C-A
16821731-A-G
17285353-G-A
18094572-T-C
18602450-C-CA
19163489-G-A
19287786-C-A
21546294-CTC-C
21546298-CTT-C
22035659-A-G
22098803-C-G
22568327-G-T
22709197-G-T
23408757-A-C
23534693-TG-T
28745767-G-A
Z16501
2892461-T-C
7147219-G-A
7522547-G-A
7626386-C-T
7855725-A-C
8156960-C-T
13854112-G-A
14184752-C-A
14842176-GGT-G
15510918-C-T
16337650-A-G
16697623-T-C
16771206-T-C
16813750-G-A
17310568-G-A
17328821-G-A
17466284-G-A
17705286-A-G
17712363-A-G
18253104-C-T
18614044-A-G
19234632-TA-T
21636045-T-C
21757569-A-G
21853770-A-AT
21936864-T-A
22461684-A-T
22487253-G-C
22487254-G-T
22651840-T-C
23300302-T-G
23401772-C-T
23746528-C-T
23968194-C-T
23980764-G-A
23984968-G-A
24280690-T-G
27894290-A-G
S1026
14006375-A-T
14423165-T-A
17316356-G-A
17624019-G-A
17782101-C-A
17861875-G-A
18082422-T-A
18208950-G-T
19279139-G-C
19289983-C-T
19505557-T-G
F579
21528825-A-C
21528833-G-T
21725192-T-C
21839644-G-C
22556211-A-C
22648960-G-A
23589353-C-T
23589354-A-G
23589357-C-T
26563768-T-A
7284742-T-C
8011152-C-T
8267650-C-G
8398228-G-A
8503404-A-T
9131385-C-T
21528826-CA-C
6968076-C-T
7703781-C-T
7888170-A-G
8144935-C-T
9380240-C-T
9971828-G-A
14249642-T-A
14751466-G-A
15057493-A-G
16340814-T-A
16496272-G-C
17850280-G-A
17924936-C-T
19451240-TCA-T
19563667-A-G
20805725-C-T
21259141-A-G
21390015-CAGA-C
21642170-G-A
22072319-C-T
22437050-C-A
22558317-G-A
22612171-C-T
22999922-T-C
23140176-G-A
23893815-G-A
8341835-A-T
8751078-A-G
14488514-G-A
8341835-A-T?
8751078-A-G?
14488514-G-A?
8284401-C-G
14210205-A-G
14357461-C-G
18171885-T-C
21668359-A-G
21705486-C-A
21799538-T-C
22138863-CA-C
22607793-G-A
28789416-G-C
7760087-C-T
7772357-T-C
8242154-C-T
8341835-A-T
8751078-A-G
13660676-G-A
14406918-A-C
14488514-G-A
21499967-G-A
22651630-G-T
24751680-C-G
6868695-C-T
6912003-G-A
7531328-C-T
7770872-T-A
7989653-G-A
8256064-G-A
8616329-C-CT
13686571-T-A
14735856-G-A
14995538-T-G
15320385-C-T
15469236-G-C
15559501-C-T
15567134-A-G
15781156-A-G
16243545-T-C
17081396-A-C
17104400-G-A
17303699-C-T
18062546-T-A
18062691-AG-A
18087733-G-T
18598641-C-A
19050672-T-C
19495832-C-T
20614125-A-G
21038718-G-C
21039278-G-C
21294159-CT-C
21468885-G-A
22774504-T-A
23639525-C-G
23851067-C-T
23869396-A-G
24483497-C-A
28804976-G-A
Z16886
Z16887
Z16888
Z16889
Z16890
Z16891
Z16892
Z16893
Z16894
Z16895
Z16896
Z16897
Z16898
Z16899
Z16900
Z16901
Z16902
Z16903
Z16904
Z16905
Z16906
Z16907
Z16908
Z16909
14069817-G-A
2721848-T-C
2724593-C-G
16252778-T-C
17212077-G-A
18663567-C-T
22200199-A-T
24907270-A-G
9903883-G-T
13997320-T-G
14924626-T-C
16299796-A-G
16527383-G-A
15526900-C-T
17927796-T-C
21286224-C-A
24364396-G-C
CTS2784
CTS2785
17591531-A-G
18935032-T-C
23539893-C-T
7350817-C-A
18742202-C-A
Z16910
Z16911
Z16912
Z16913
Z16914
Z16915
9029781-G-A
Z16916
Z16917
Z16918
Z16919
Z16920
Z16921
Z16922
Z16923
Z16924
Z16925
21929626-C-T
Z16926
Z16927
Z16928
9029781-G-A?
6913407-G-T
9132595-T-C
14072774-C-G
15341741-T-C
16364133-CAT-C
17516985-T-G
17847709-C-T
18545747-A-G
22825934-G-T
S516 Z351
6371500-T-C
8537595-A-T
8550840-A-G
9476088-G-A
13654844-A-T
16325056-C-A
17705456-C-T
18204013-AG-A
19305408-G-A
19396266-C-T
22461484-G-A
21929626-C-T?
7073881-G-A
8454839-G-A
13665956-A-G
14106257-G-A
14745863-G-A
21917316-C-G
21919172-C-G
21919223-C-G
7245412-C-T
7628376-G-T
7652719-A-T
7658012-T-C
PF5709
7949547-C-A
7988738-T-C
8090404-AT-A
8216944-T-C
8435741-C-G
8438913-C-G
8440589-T-C
9009237-G-A
13679197-G-A
14345937-C-T
14591184-ATGT-A
15153533-G-T
16202156-G-A
16403854-G-A
16651705-C-T
16670749-G-A
17491274-T-C
18917019-G-A
18922292-C-T
19169887-G-A
21666649-G-T
22175711-G-A
22246115-T-A
22711814-C-A
22911625-G-A
23402688-T-G
23409289-A-G
23493980-T-C
24620410-A-T
28022451-C-A
S1051
FGC9661
FGC9660
S1050
4567341-C-A
FGC18003
9871149-A-G
FGC9660
M9701
15915724-C-T
16937513-G-T
16983358-C-T
17046052-AGA-A
17106665-C-CTA
17400634-C-T
17997132-A-T
18832872-T-C
19056509-A-AA
21046495-A-G
21258195-G-C
21345840-T-TT
FGC17982
FGC17993
21567829-G-T
22271792-C-T
22523835-T-A
22555381-T-TT
22870054-A-G
22991910-A-G
CTS12952
CTS12953
CTS12954
2851754-T-A
FGC14899
FGC14900
FGC14901
FGC14902
FGC14903
FGC14904
FGC14905
9148529-A-T
13678453-GGAATGGAAAGGAATA-G
FGC14906
FGC14907
FGC14908
FGC14909
FGC14910
FGC14911
FGC14912
14692200-C-T
FGC14913
FGC14914
FGC14915
FGC14916
FGC14917
FGC14918
FGC14919
FGC14920
FGC14921
FGC14922
FGC14923
FGC14924
FGC14925
FGC14926
FGC14927
21186715-CAGAGGTCACT-C
FGC14928
FGC14929
FGC14930
FGC14931
FGC14932
FGC19414
7069724-C-A
FGC19423
8578252-G-C
8827732-TA-T
FGC19424
13715279-T-C
FGC19428
FGC19431
14659263-A-G
FGC19436
15441076-AAG-A
17185145-A-T
FGC19441
FGC19442
FGC19443
18172798-G-C
FGC19445
FGC19448
FGC19450
19422885-TCTC-T
21241396-G-A
FGC19452
FGC17906
22445987-A-C
22457361-A-C
23042271-GT-G
23099212-A-G
23614164-C-A
23621002-C-T
FGC19455
FGC19456
2903693-C-T
6689053-G-A
7189475-C-T
7830351-T-A
7978218-C-A
8040363-A-AT
8096600-T-C
8259316-C-T
8264301-A-T
8394804-C-A
9845293-C-G
9880458-T-A
13660097-G-A
14094711-G-A
14452352-G-A
14968023-A-G
15317075-A-T
16077864-T-C
16697575-A-G
17304455-G-T
17339922-C-G
17441045-C-G
17811857-G-C
17872424-C-T
18772709-G-A
18841347-T-C
19078113-C-T
19212890-A-G
19538903-G-A
21192389-C-A
21254801-T-A
22263365-G-T
22458785-G-A
22470166-A-G
22479043-T-C
22479046-C-G
22479049-G-T
22479054-A-T
22629091-C-T
22923312-G-A
23191682-C-G
23846642-A-G
24510883-T-G
4581312-T-G
6931130-C-T
7593440-G-A
8309981-T-A
9029994-T-C
9376381-C-T
9376382-A-G
13296610-T-A
13804695-T-C
14095228-G-T
14116132-A-G
14433243-G-A
14864741-C-T
14867500-G-A
15401561-G-A
16238919-C-T
16373482-G-T
16951240-G-T
17273709-G-A
17696379-C-G
19050505-C-T
19322237-G-A
22438770-A-T
22465709-A-T
22648751-G-T
22751315-CA-C
22751320-T-G
23891761-A-G
S470 Z251
Z18600
Z18600?
Z16943
Z16944
Z16929
Z16930
Z16931
Z16932
Z16933
Z16934
Z16935
S20749
Z16936
Z16937
Z16938
Z16939
Z16940
Z16941
L557 S394
Z16942
Z16945
L555 S393
Z16946
Z16949
FGC8673
Z16947
Z16948
Z17660
16344311-TT-T
16344316-TCT-T
8531427-C-T
14750280-ACCAGTGTGGATTGTTCCCCTCCCTGTGT-A
16561158-A-G
21515424-T-A
21950915-G-T
Z17660?
16344311-TT-T?
16344316-TCT-T?
FGC19534
FGC19535
FGC19537
FGC19538
FGC19539
FGC19531
FGC19532
16344316-TC-T
2888666-CCTGG-C
Z16944?
Z16947?
Z16948?
8094631-G-A
17193400-C-A
17319595-G-A
18680369-A-AA
19263733-T-A
21368012-G-A
21613126-AA-A
21782548-T-G
6627009-C-T
6923458-A-T
7618284-G-A
8502668-T-C
9165645-T-C
14126000-G-A
14141832-C-G
14902155-A-T
15016095-G-C
15810263-G-C
16572580-T-C
16731581-G-A
16970830-G-A
17583465-A-G
17719228-G-T
Z8011 FGC7549
18732995-G-A
19156544-AGAG-A
19180550-C-T
21493227-G-A
21821970-T-A
21993064-C-T
22005010-C-T
22084534-G-T
22461367-A-T
22473161-T-G
22598257-A-C
22783578-C-G
CTS4157 S3741
7811334-T-G
8014363-G-A
8069451-G-T
8113019-A-G
8258016-G-A
8260400-G-C
14787760-A-G
M4561
15895689-C-T
16191970-A-AT
16898721-T-G
PR2391
17287553-A-G
17287557-A-G
17686494-G-C
18118098-G-A
18128924-G-C
18412595-A-G
19033206-A-G
22440933-G-A
22485464-A-T
22631977-C-A
22795254-G-A
22898242-T-C
23067429-C-T
23389232-A-G
23762640-T-C
6941993-C-A
7032732-CCTT-C
7146018-G-A
9393067-G-A
13678913-G-A
FGC19665
13831770-T-G
14028921-G-T
14147333-C-A
14652930-G-A
15182702-C-T
15237482-C-T
15407615-G-T
15718502-A-C
16713695-A-C
17492535-A-T
17637560-T-C
18032506-C-T
18248539-T-C
19452081-C-A
21438692-T-G
21785353-T-G
21908464-T-G
22437534-G-A
22888922-G-T
7333259-C-T
8427807-C-T
8493976-C-T
8537087-T-C
9850734-A-T
FGC8673
13831355-G-A
14546262-C-T
14855614-T-G
15985023-ATAATCTAGAAT-A
16286681-A-G
16373210-T-C
16515629-A-G
17055629-G-A
17055630-G-A
18894336-C-T
19206065-T-G
19456514-G-A
21051384-G-A
21312857-G-T
21920865-C-T
22438727-A-C
22438728-C-T
22438732-A-G
22438739-C-A
22438748-G-C
22472605-A-T
22748814-A-G
22900526-T-C
23889302-A-G
24005757-A-G
24476514-A-G
6138777-C-T
6958056-T-A
8234842-C-T
8509097-T-G
8591862-G-T
8909873-T-G
10010222-G-A
13833842-G-A
14010437-G-A
14405584-C-CT
14638383-G-A
14881233-A-G
15089718-C-G
15328599-C-A
15880567-T-C
16172619-C-G
16329795-G-A
16366595-C-G
16366619-A-G
16782415-T-C
16786335-A-G
17277522-T-C
17850423-T-C
18026704-A-G
19179416-C-A
19206927-T-A
21110673-C-T
21259853-C-A
22579928-C-A
27643867-G-A
S11556
S9294
Z18090
Z18091
Z18092
Z18093
Z18094
Z18095
Z5303
Z18096
Z18097
Z18098
Z18099
Z18100
Z18101
Z18102
Z18103
Z18104
7531508-A-G
7764980-G-T
8482196-G-A
8574703-C-G
9048720-T-G
13841029-C-T
15345396-A-C
15972200-A-C
16667718-T-C
16895636-A-C
17072668-C-G
18003483-G-A
18713899-C-A
19367665-G-T
21334035-A-G
22019579-A-G
23153490-C-T
14010495-G-A
14979948-G-GA
15784924-G-A
16203419-C-G
16230611-A-G
19250722-G-A
21070690-G-C
22201494-G-T
23729854-T-C
24438776-T-C
2720792-A-G
6851572-A-G
6932602-G-C
7171805-G-A
7387444-A-T
7607234-C-T
7763766-T-C
8750210-A-C
9398985-A-G
CTS2220
14498309-A-G
14890647-T-C
15278413-A-G
15501050-GC-G
15594216-TATTA-T
15901848-A-G
16077845-A-G
16876677-C-CCT
17107221-C-T
17149441-A-G
V68
17981134-G-T
18929071-T-TA
18951682-C-T
19315225-T-C
21567470-A-AGT
21702820-C-G
22261119-A-T
22270664-C-A
22445257-G-C
A301
A302
A297
22678289-T-G
22890843-C-T
23262319-T-A
FGC15606
FGC15607
FGC15610
FGC15611
FGC15612
FGC15613
FGC15614
FGC15616
FGC15617
FGC15618
FGC15619
FGC15620
FGC15621
FGC15622
17942028-A-T
FGC15623
FGC15624
22075377-TCACA-T
FGC15625
22474016-C-T
FGC15626
FGC15627
FGC15628
FGC15629
CTS214
6962660-T-C
7313842-G-T
8096787-T-C
8229117-G-T
8390981-A-G
13455011-A-C
13991707-A-G
14185387-G-A
S15808
15707766-G-A
15750398-C-G
15776056-G-T
16121672-T-TAAAG
16132498-C-T
16196872-C-T
16287909-G-A
16669845-T-A
17946114-C-A
M4087
18758660-C-CA
19235112-A-G
19323400-C-A
19467958-T-C
21233564-C-T
S23286
22444642-G-T
22462413-C-A
22514726-A-T
S9294?
2764614-A-G
2867537-T-G
6187255-C-T
6925336-T-G
7290630-C-G
7364735-G-A
7813686-C-T
8524060-G-A
9159726-T-C
14051398-G-A
CTS2224
16598417-C-A
16747426-C-A
17670594-G-C
18031925-C-T
18092401-C-A
18945713-C-T
19270475-T-G
19366412-T-C
19379807-C-T
21040259-A-G
21407294-T-G
21603308-G-A
22256714-A-C
23590770-A-C
23735056-A-T
24427512-C-G
FGC11975
FGC11976
Z10164
FGC11978
FGC11979
FGC11980
FGC11981
FGC11982
Z18105
FGC11983
FGC11984
A555
FGC11988
FGC11990
Z18106
FGC11991
FGC11992
FGC11994
FGC11962
FGC12001
FGC12002
FGC13578
FGC13579
FGC13581
A693
FGC13582
FGC13583
FGC13584
L583
FGC13585
FGC13586
FGC13588
FGC13589
FGC13590
FGC11964
FGC11965
FGC11966
FGC11968
FGC11969
FGC11970
FGC11971
FGC11973
FGC11974
FGC11977
FGC11985
FGC11986
FGC11987
FGC11989
FGC11993
FGC12003
FGC11996
FGC11997
FGC11998
FGC12000
FGC13591
FGC13592
FGC13593
FGC13594
FGC11963
FGC11967
FGC11972
FGC11995
FGC11999
FGC13577
FGC13580
FGC13587
FGC13576
19273484-A-G
FGC12409
FGC12411
14082997-A-AT
FGC12413
FGC12414
FGC12415
FGC12417
FGC12418
FGC12419
FGC12420
FGC12421
21504293-T-C
FGC12422
FGC12423
21740398-C-T
22470558-C-T
22478027-G-T
22478050-G-T
22478053-T-A
22478065-C-CT
22478080-C-A
22478081-C-A
22483440-A-C
FGC12425
FGC12426
FGC12427
FGC12428
FGC12429
FGC12430
Z17662
Z17663
Z17664
Z17665
Z18107
Z18108
Z18109
Z18110
Z18111
Z18112
Z18113
Z18114
Z18115
Z18116
Z18117
Z18118
Z18119
Z18120
Z18121
7643546-G-A
14328881-G-A
15421480-A-G
17236037-A-C
19141887-G-A
22439173-A-T
22439174-G-T
22442141-G-A
24071936-C-T
8061238-T-G
13221359-T-C
21361245-A-G
Y2398
FGC17398
6841219-G-A
6953881-A-T
7277920-C-G
7361133-C-A
7611167-A-C
7807517-G-A
8291909-G-C
8784850-G-A
9459192-T-A
9832308-C-G
14222734-C-T
14380610-T-C
14841173-G-C
15356205-A-G
15939761-C-T
16537874-T-C
16553262-C-A
17150484-G-T
S19558
17344884-G-T
17821604-C-T
18083783-G-A
18215370-A-G
19289133-C-T
19395221-G-A
22238913-T-A
22272700-C-T
22444349-C-T
22596149-G-A
22733643-C-T
22926258-C-T
23056766-A-G
23610747-T-C
23632160-C-G
FGC13899
A242
A244
A245
A246
A247
A248
A249
A250
A251
A252
A253
A255
A256
A257
Z17666
22715638-GA-G
A258
A228
A232
A238
22634793-A-C
A241
A243
A254
8055923-TTA-T
A239
A237
CTS9686
M6346
A235
A236
A240
18060275-CAT-C
A229
A230
A233
A234
A232
8608085-G-T
8991479-A-AT
14997361-G-A
18251909-C-A
19309390-A-G
22093714-C-T
24441503-C-A
8055923-TTA-T?
CTS9686?
A545
A546
A547
A548
A549
A458
A551
A552
A553
A554
A550
BY118
8248346-A-C
14024753-A-G
14126834-T-A
14433970-C-G
14433975-G-C
14497946-C-T
15074199-A-G
16614492-T-C
17275137-A-G
17942821-T-C
18596133-T-C
18640600-G-A
21227566-C-T
22006418-T-C
22479008-T-C
23446708-A-C
7285427-CAAAT-C
FGC19787
FGC19788
FGC19789
FGC19790
FGC19791
FGC19792
FGC19793
FGC19795
15720379-GAAAT-G
FGC19796
FGC19797
16359049-G-A
17275755-AGAAAAGG-A
17275765-AGGG-A
FGC19798
FGC19799
FGC19800
FGC19801
FGC19802
FGC19803
FGC19804
FGC19805
FGC19806
FGC19807
FGC19808
S470? Z251?
2699821-G-A
7179071-G-A
8597476-G-C
8804033-C-T
9109786-T-G
9842951-A-G
10025657-C-T
13836542-C-T
14005086-G-A
14026096-G-C
14095102-T-C
14324037-T-C
14409901-G-A
15547552-A-G
15845119-G-A
15977342-A-G
16222056-C-A
16235822-C-T
16473087-C-A
17172333-A-G
17457085-AC-A
18220349-G-T
18247782-G-C
19171777-C-T
19261498-C-T
19306841-A-G
19397608-C-A
19439755-C-T
21616998-T-C
21758385-G-A
22117083-A-G
22513724-C-T
22709944-G-T
22818761-T-TA
23823703-T-C
FGC18234
FGC18235
FGC18236
FGC18232
FGC18237
FGC18238
FGC18240
FGC18242
FGC18243
FGC18244
FGC18245
FGC18230
FGC18246
FGC18247
FGC18248
FGC18249
FGC18251
FGC18252
FGC18253
FGC18254
FGC18255
14708427-AAT-A
FGC18256
FGC18257
FGC18258
FGC18259
FGC18260
FGC18261
FGC18262
FGC18263
FGC18264
FGC18265
FGC18266
FGC18267
FGC18268
FGC18269
FGC18271
FGC18272
19433430-TG-T
FGC18274
FGC18231
FGC18229
FGC18275
FGC18276
FGC18239
FGC18241
FGC18233
FGC18250
FGC18270
FGC18273
21524511-TAA-T
6761816-G-A
7271847-TTCC-T
7333476-A-G
7674198-G-A
13714736-G-T
14294745-G-A
14888942-T-C
15047387-C-T
15509364-A-G
15625441-A-AGCCCAAATTTTG
15656869-A-C
15715769-C-T
16202567-C-T
16557467-A-G
16570171-G-T
17038151-G-C
17047688-C-A
18289941-C-T
18805707-G-A
19086845-C-T
19091205-A-T
20047330-T-C
21838742-T-TA
22246041-G-A
22458523-C-A
22685106-G-A
22759437-A-G
22903149-G-A
23266828-C-A
23348099-A-G
23781178-T-C
ZZ10
2658228-T-A
2766266-G-A
8146128-A-T
8484764-A-G
9036026-C-T
9834162-G-A
13653471-G-C
14312808-C-T
14491214-T-TAAAC
14536515-TGAG-T
14710661-A-G
15724728-CAG-C
16255233-A-C
16628443-T-A
17051895-G-A
17356089-C-T
17788984-A-G
17794587-A-G
17802982-C-T
17802983-C-T
17937807-A-G
18107732-G-A
18391277-T-A
19109146-G-A
19499151-C-A
21155953-G-A
21260902-T-A
21303878-A-G
21342470-C-T
21547103-G-A
21569859-C-T
S23590
22271403-C-G
22274584-T-A
22299829-C-A
22312714-A-T
22340245-T-C
22362360-C-T
22420156-C-A
22829899-C-T
22835250-A-T
23056626-G-A
23193354-T-A
23502899-G-A
CTS3386 S3658
S10707
S11699
S17999
S20753
CTS10044
S25201
CTS5846 S3654
S25948
S19268
2747390-C-G
S9793
S9797
FGC13300
7654353-G-T
FGC13298
FGC13301
S11329
FGC13304
FGC13305
14955205-A-T
FGC13306
16247201-C-A
16514373-C-G
16520271-CATT-C
17082725-G-A
FGC1986
18255046-A-T
22271012-T-A
22271019-C-A
22440365-C-A
FGC13299
FGC13307
FGC13308
23070835-A-G
FGC13309
S26084
FGC13302
2877789-G-A
4925615-T-C
6593928-G-C
6931120-G-C
7216931-T-G
7583951-T-C
8381040-T-A
9056177-G-C
9880983-T-A
13649650-T-C
13888070-C-A
14217553-G-T
14836635-G-A
15336776-C-A
15373188-T-A
15713502-G-A
17120053-T-C
17424804-C-T
17571047-G-T
17816060-ATT-A
17971607-C-T
18163911-C-A
19442873-G-C
19468963-G-T
19483753-C-CCA
22271294-G-T
22469616-G-T
22476962-T-A
22525479-T-C
22751613-T-G
22815603-G-C
23040818-A-AT
23992544-G-A
24449571-A-T
24521589-G-A
28461208-G-C
Z17970
Z17971
Z17972
Z17973
Z17974
Z17975
Z17976
S3662
Z17977
Z17978
Z17979
Z17980
21996232-G-GGTT
7176451-C-T
7399736-G-A
8071527-G-A
9146482-G-A
13983538-G-C
14972549-G-T
17130974-G-A
18235594-T-C
18912447-G-A
18940558-C-A
21561725-G-T
22047274-TA-T
22465154-TG-T
22537953-C-G
22567136-A-G
22786312-G-A
23462611-T-C
7191465-G-A
7832075-T-TTCTTTC
7869358-A-G
8106570-A-G
14039812-C-T
14062323-G-T
14169737-A-C
15309738-G-A
15696338-C-T
CTS6705
17416284-C-T
18234409-G-A
21412647-C-A
22559427-C-T
MC14
Z17633
22462334-C-T
22462335-G-A
22462340-C-T
22462359-A-C
22462367-A-T
22462414-G-T
22462420-A-C
7018470-T-G
7421536-T-G
8412309-T-A
9150080-A-G
14236813-C-T
PR1412
14641164-G-A
16401977-A-G
16812415-T-G
16819986-T-A
16938759-C-T
16960757-TATG-T
17053780-C-T
17175124-G-T
17287452-A-T
17289419-G-A
17516531-G-T
17845536-G-A
18061611-A-G
18763116-C-T
19113557-T-A
19267380-AC-A
19287775-A-G
21036236-T-A
21127694-C-A
PF3449
PF3873
21925147-T-C
22041410-G-A
22294372-T-A
22419755-C-T
22906320-G-A
23032734-C-T
23377534-TA-T
23765438-G-A
23892538-A-G
24482209-G-A
6837357-C-A
8483229-G-A
8530226-A-T
9123060-C-A
9405059-T-A
14201117-C-T
14602359-G-T
16690838-C-T
16756320-T-C
16791472-A-G
17114271-C-T
17663614-T-C
17957590-G-A
18241512-A-C
19359241-T-C
20028014-A-G
21924822-G-T
23329693-T-A
23607573-C-T
23762240-A-C
23792149-T-A
L229
L207
L393
6932306-G-C
7461503-A-G
13666891-G-T
14365718-G-C
14747500-C-A
15025240-A-C
15071019-A-G
15271994-C-T
15307077-TA-T
16060868-C-A
19543393-C-A
CTS11853
6190281-A-G
7887032-C-T
8496849-G-A
9389812-G-A
17180247-G-A
17447265-T-C
17707103-C-T
17794768-C-G
17958784-T-C
18686637-C-G
19452200-G-A
21407280-A-T
22654469-C-T
S218 Z253
S471 Z252
S868 Z2534
FGC5618
FGC5625
FGC5626
FGC5627
FGC5632
FGC5636
FGC5641
FGC5642
L226 S168
FGC5646
FGC5650
Z17667
Z17668
FGC5651
FGC5652
Z17669
FGC5655
FGC5656
FGC5657
FGC5660
Z18122
FGC5654
FGC5659
Z17670
FGC5637
19683157-C-G
9160254-C-CAT
FGC5638
FGC5628
9160254-C-CAT?
19683157-C-G?
FGC5619
FGC5620
FGC5621
FGC5622
FGC5623
FGC5624
FGC5629
FGC5630
FGC5631
FGC5633
FGC5634
FGC5635
FGC498
FGC5639
FGC5640
FGC5643
FGC5644
FGC5645
FGC5647
FGC5648
FGC5649
FGC5653
FGC5658
FGC5654?
FGC5637?
DC1
PF3081
22273352-C-G
22273358-A-G
22273370-G-A
22273371-T-A
22273380-T-A
28786856-T-C
14711040-C-T
7800527-A-G
16175399-C-G
22861923-C-T
22019398-T-A
22445926-T-G
23534411-A-G
9648265-A-T
15361402-C-T
15974550-T-G
16513543-T-C
17658763-C-A
21080057-C-G
22235989-T-C
22235991-G-A
22238965-T-C
22896686-A-G
23292869-G-T
2842347-TGAGTAGCTG-T
FGC5637?
9443821-A-C
17703583-G-T
18945772-C-T
21063873-C-T
21674008-CA-C
22273053-C-T
22294406-T-C
19683157-C-G?
FGC5654?
FGC5637?
PF5351
7765005-A-T
13304119-G-A
14116023-C-T
14356061-C-A
15551596-C-A
17240213-C-T
22472944-G-A
22677271-G-A
7464461-T-C
15167648-A-C
16227504-C-T
17890054-C-T
19141149-CTATT-C
22815710-T-C
8202736-A-G
8545140-C-T
17841946-G-A
23151374-A-G
FGC5659?
FGC12293
FGC12294
FGC12295
FGC12296
FGC12297
18612789-A-G
FGC12298
FGC12299
FGC12300
FGC12301
22485755-C-A
FGC12302
FGC12289
FGC12290
FGC12291
FGC12292
9173312-G-C
FGC5659?
7928319-G-A
8320566-A-G
8640994-C-A
13657216-C-A
16907885-T-C
17223939-G-C
17818962-C-G
21082812-T-C
22241993-G-A
22529281-A-C
22549788-T-C
22551523-A-T
ZZ5
CTS2646 Z2182
S883 Z2184
CTS9975 Z2185
22319210-A-G
Z2186
CTS1202 L1066
Z2183 Z2183
6673834-T-TA
8147777-C-G
8187750-C-T
8331346-C-T
9389602-C-A
14373433-G-A
14507471-C-T
14870231-A-G
15473859-G-A
15571544-T-C
15737049-C-G
16789367-T-C
17040035-A-G
17081142-C-A
17579433-C-A
17709207-A-G
21263882-G-A
22483291-G-T
22634711-C-T
22764117-C-G
23046480-C-T
23124093-G-T
23479050-G-A
23537827-C-T
23842801-A-G
23990311-G-A
24450902-G-T
2737698-A-G
6793420-T-C
6960300-A-G
7693872-T-G
7815964-C-T
8994136-T-G
9813750-C-G
15229051-C-A
16313441-A-C
16533944-C-T
17355178-T-A
17530703-T-C
18147093-C-T
18147094-C-A
18803570-T-G
CTS10108
19486275-A-G
21180266-G-T
21285171-G-A
22020859-C-T
22423574-C-A
22444854-C-T
22469833-T-A
23111968-G-A
2838117-A-G
3406761-G-T
8328498-T-A
8483291-C-G
9090868-G-A
9127425-G-C
9852264-T-C
9853875-A-G
9854014-T-C
14751390-A-G
15336187-A-C
16372096-A-G
16802177-T-C
17279776-A-T
18641959-T-C
M2268 Y539
21682601-TGA-T
21905468-A-C
22038140-A-C
22160069-A-T
22272657-C-A
22462048-G-A
22462049-A-T
22478093-C-T
22756404-G-A
22946961-A-G
23562264-A-G
24007265-C-T
24481030-T-A
24484376-A-G
PR4692
9904732-C-T
14001735-T-C
14096805-C-T
14105084-A-AACAG
14410499-C-T
14703344-G-A
14744722-A-G
15074426-A-C
15138732-A-G
15289103-G-T
15513916-G-A
15524227-CT-C
16823264-TTATCTC-T
17031794-G-C
17322643-GGAAGGAAA-G
18084686-C-T
18613135-A-C
18958406-CAGTT-C
S21846 L1443
21471928-A-AT
21687093-A-G
21731580-A-G
22261167-A-G
22261170-G-A
22261173-G-T
22261196-C-T
22273020-C-A
22294078-G-T
22443858-C-A
22469601-G-T
22476231-G-C
22848291-C-T
FGC17240
7958587-AC-A
FGC17241
FGC17242
FGC17243
FGC17244
FGC17245
FGC17246
FGC17247
FGC17248
FGC17249
FGC17251
FGC17252
FGC17253
FGC17254
FGC14934
FGC17255
FGC17257
FGC17258
FGC17259
FGC17260
FGC17262
FGC17263
21937612-T-TA
FGC17264
FGC17265
FGC17267
FGC17268
FGC17269
FGC17270
FGC17271
FGC17272
25961107-C-T
28757794-C-T
Z17671
Z17672
Z17673
Z17674
Z17675
CTS6906
Z17676
CTS7513
Z17677
CTS9881
CTS10558
A139
CTS11831
CTS11843
Z17678
Z17679
Z17680
CTS1788
CTS9251
Z18123
Z18124
Z18125
CTS12232
28767345-G-T
Z18126
Z18127
Z18128
Z18129
Z18130
Z18127?
6931953-G-C
7659715-A-C
10045730-T-A
16404497-T-C
18547785-C-T
19181248-A-AT
19468467-G-A
22273089-G-A
8635043-A-T
14697554-A-G
14971750-A-G
16183479-C-T
18181598-A-G
22158226-G-A
22256444-C-G
23624779-A-G
6936272-G-A
7550079-A-G
14281617-G-C
16404863-A-G
16641598-C-T
23587380-T-C
6864510-C-T
7508732-T-C
8589709-G-A
13657885-C-A
14610344-T-C
15281293-G-A
CTS4296
16756413-A-G
17577925-G-T
17895043-C-A
21303622-C-T
23485249-C-A
24426760-C-T
CTS12232?
7084898-T-C
7599981-A-G
7872776-G-T
8438807-C-A
9172571-C-A
19272138-A-C
19483017-A-G
22479531-A-T
23191427-A-AT
23191431-A-T
23296439-G-A
23307565-C-T
2807063-T-A
6716762-T-A
6868115-G-A
7290832-CTA-C
8582930-T-C
8797139-C-T
10045940-A-C
13661848-T-C
14572216-TC-T
17005665-G-A
17043758-CT-C
17516945-A-G
17911742-T-C
18121962-C-T
18557753-G-A
18609977-T-C
19187890-C-A
19187891-T-G
19187894-T-TACATACAG
19220292-G-A
21635432-C-G
21642123-C-A
23091364-A-G
23534926-A-G
23841986-AG-A
24377156-G-C
28784979-G-A
2826730-T-G
6718174-G-A
6845204-G-A
6879990-A-C
7419077-CAT-C
7591415-A-G
8506262-A-G
8514440-A-G
8537069-G-A
8697250-G-A
9062693-C-T
9107641-G-A
9440044-G-C
14226795-T-A
14918907-A-G
15414422-C-T
16906221-T-C
17042224-T-G
17411948-T-C
17864261-A-C
17893912-G-A
17985201-C-T
21144379-C-T
21375244-T-C
21508669-C-A
21627488-C-T
22186098-A-T
22206228-T-G
22442204-G-T
22470496-C-T
22470741-G-C
22478165-A-T
22556438-C-T
22583565-A-G
23242834-T-C
23748820-C-G
23864412-C-T
A287
A288
A532
2654262-G-A
6859429-T-C
7245482-C-G
7402565-T-G
7521474-G-A
7950574-T-C
8185673-G-T
8433911-G-C
8618063-G-C
8701010-G-A
8837956-A-G
9091938-A-T
9648424-A-C
13658388-A-G
13691096-T-G
13843048-GTGGAA-G
14168347-G-A
15359395-T-C
15518754-A-G
15754692-C-T
15970968-G-T
16650674-G-A
16820679-C-G
17263638-G-C
18083707-T-C
18774040-A-G
19466851-G-A
PR6936
22004215-T-A
22186305-G-C
22263230-C-G
CTS11291
23063244-C-T
23523159-T-G
23839176-T-A
2886526-A-G
6789716-C-T
6883370-A-G
6883376-C-T
6883386-A-G
6883393-G-A
6883402-C-A
6883407-A-G
9148441-A-C
9374860-C-T
9789453-T-G
14452009-G-T
15467086-C-A
15656226-C-T
15660491-C-T
16877487-C-G
16934890-T-C
17408745-G-A
17832671-C-T
19322678-G-A
21837348-C-G
21837427-A-C
22102112-G-A
22520140-G-C
22557145-G-T
22720078-G-A
22920121-G-A
23187028-C-T
23562231-G-A
23605591-G-A
23785105-A-C
23856669-C-T
24278189-A-G
24600521-T-C
FGC17551
FGC17552
7144319-G-A
FGC17553
FGC17554
FGC17555
8467389-G-A
FGC17556
FGC17557
FGC17559
9732325-G-C
FGC17561
FGC17562
FGC17564
16834985-C-CT
16970419-A-T
FGC17565
FGC17566
FGC17567
FGC17568
FGC17569
FGC17570
19346450-C-CTT
FGC17572
FGC17573
FGC17574
FGC17575
FGC17576
FGC17577
FGC17578
FGC17558
FGC17571
9907007-G-A
16230358-G-A
M1922
A276
A14
A277
A16
15124404-CT-C
15124410-TTG-T
16582972-TAGC-T
23314334-AG-A
8482874-G-C
8539300-C-G
9141725-C-T
14227060-A-G
16366777-T-A
16402805-G-A
17217786-T-C
17488521-G-A
17715253-G-A
17805728-C-T
19518855-C-T
20816306-G-C
21528846-A-C
21568551-G-T
21735224-TAA-T
L643
21960279-G-A
22019983-G-T
23043095-C-A
23153085-C-G
28747093-T-G
18992234-G-GT
22470525-G-A
23515359-TTAAACGTAAAGC-T
24444442-C-T
27053513-G-A
9096492-C-A
13605236-G-A
15375516-A-C
3876320-C-T
6883626-TATC-T
7074262-T-C
7252131-G-A
7954181-T-G
8438818-C-T
8479985-C-A
8973567-C-T
13221007-C-A
13653296-G-C
16442285-A-T
17905890-G-A
18244269-G-T
18578343-A-G
18772638-G-A
19116678-T-C
19240396-A-G
19304545-C-A
19304928-C-T
21724552-G-A
22814375-G-A
23079346-C-T
23155187-C-G
23591666-A-G
23851681-A-G
23872013-C-T
7615558-G-A
FGC8259
FGC8260
9518278-G-A
FGC8264
FGC8265
FGC8266
15255768-G-A
FGC8268
FGC8270
FGC8244
FGC8274
FGC8275
FGC8277
18128897-C-G
18128935-AA-A
FGC8278
FGC8279
FGC8281
FGC8283
22263290-A-C
22460582-A-T
22467511-G-C
22479967-G-C
FGC8290
FGC8293
23894911-T-A
FGC8295
8223985-T-C
Z2189
Z2190
Z2191
S928
S932
Z2195 S934
Z2197 S935
Z2201
Z2202
6762613-G-T
DF73 S923
7801188-A-G
8243102-G-T
Z2188
9394179-T-C
14426636-C-T
14933671-C-G
15408164-G-C
16086229-C-T
16641612-CAA-C
17011888-T-C
17354499-C-G
S933
18673117-T-A
18746112-TAAC-T
18773144-T-G
19187157-C-A
21667797-A-G
S941
23134592-C-T
28588901-A-T
28590320-GAGT-G
6346989-T-C
6960552-T-C
6967315-G-A
8126885-G-A
8355745-T-G
8363147-A-T
8411886-G-T
8818019-T-A
9072522-G-GTTGTAACAC
14185083-G-C
15524064-G-T
15832452-C-A
16326262-A-G
17685550-G-A
17946208-C-G
21053390-A-C
22460514-G-T
22462901-G-T
22463624-G-T
22465506-A-T
22860120-G-A
6696255-G-C
6708044-T-C
7622894-C-T
8038161-G-A
8327180-A-G
9024586-A-G
9115634-C-G
13657862-G-A
14394319-G-A
14969296-C-A
15715180-G-A
15964028-C-G
16243264-T-C
16504528-C-T
16567589-G-A
17282934-G-A
17843848-T-A
17907568-C-T
18670446-C-T
18900315-T-C
19184307-G-A
19439264-GA-G
20823807-T-C
21253044-T-A
21530416-G-C
21882306-C-A
21936733-C-T
22140561-G-A
22212486-T-A
22239378-G-C
22475672-T-A
22513513-G-A
23145061-G-C
F3590
FGC13898
S847 A19
S850
A20
S853
S854
S855
S857
S859
S860
A22
S865
A25
S841
S844
A17
Z17681
Z17682
S849
FGC13896
S848
Z17683
S856
FGC13897
S845
FGC8536
FGC8533
FGC8537
FGC8539
FGC8561
Z17684
Z17685
7639478-T-C
8205984-C-T
13384734-TA-T
15409903-G-C
16231792-A-G
16400337-T-C
16556414-T-C
17936177-T-C
21869924-T-G
22916308-T-A
23020893-C-T
18386296-C-A
18786304-T-C
21200999-C-A
22298108-G-A
22462256-A-T
M8325
22914882-G-A
23057017-G-T
23595648-A-T
FGC8537?
2856244-C-T
7326253-A-T
8127819-C-T
8781683-G-A
8902467-C-T
9106128-G-T
15312873-G-T
15811681-G-T
M8167
20065928-A-G
22484292-C-T
22898319-G-T
23514808-C-A
Z17684?
FGC8551
FGC8552
FGC8556
FGC8558
19200021-TG-T
FGC8560
23067495-C-A
28711595-A-T
14744886-T-C
16444791-T-C
16715698-G-A
19049321-T-G
8143316-C-A
L1308
16132528-A-G
16807024-C-G
19068511-C-T
19420365-T-TTC
22581535-T-A
18052869-T-G
22460926-G-C
18052869-T-G?
16808702-A-G
17494730-T-G
17614261-A-G
22460926-G-C?
24469369-C-T
FGC8041
17807138-G-A
18044450-A-G
24499594-C-T
6915112-C-T
8875157-G-A
8894229-A-T
14315887-C-T
16828460-T-G
19199569-T-C
21640052-C-T
22271583-G-A
23419989-TTGTC-T
24007867-G-C
S844?
8054201-A-G
8752549-A-G
9376419-C-T
14730042-GT-G
15331942-G-A
16823581-C-A
17841768-G-T
18773003-G-A
22472868-A-G
23801265-T-G
F4036
ZZ6
FGC3249
Z17686
FGC3222
Z17687
FGC3233
FGC3235
FGC3237
FGC3238
FGC3239
Z17688
Z17689
Z17690
FGC3244
FGC3245
FGC3247
FGC3252
FGC3253
FGC3255
FGC3256
FGC3257
FGC3260
FGC3261
FGC3262
Z17691
FGC3234
FGC3236
Z17692
FGC3258
FGC3265
FGC3270
FGC7855
FGC3221
PF825 PF825.2
15236809-A-G
17034566-G-A
18820046-T-C
21086154-A-C
22200185-C-G
7750379-G-C
9134846-C-G
9179693-T-G
L430
FGC3219
FGC3220
FGC3268
FGC3223
FGC3224
FGC3225
FGC3226
FGC3227
FGC3228
FGC3229
FGC3230
FGC3231
FGC3232
FGC3240
FGC3241
FGC3242
FGC3243
FGC3246
FGC3248
L1495 PR2573
FGC3250
FGC3251
FGC3254
FGC3259
FGC3263
FGC3264
FGC3266
FGC3267
FGC3269
8357214-G-A
13983101-G-T
14657114-C-A
22477195-AG-A
7654221-G-A
7938236-C-T
8460727-TG-T
16768254-G-A
18118587-C-T
19533164-C-T
21947653-T-G
22538624-A-G
22755905-C-T
22813052-C-G
2716728-G-C
9144082-A-G
9162785-T-G
9162852-A-T
9810644-G-C
14211616-C-T
14277126-G-A
14487835-C-T
15489540-C-T
18235777-G-A
18959917-C-T
19239988-C-A
19379989-C-A
19517098-A-T
22158840-A-T
22213189-C-G
23365738-G-A
23994488-C-A
25095106-T-C
8107082-T-C
8285977-C-T
8840387-CTTTT-C
14200992-C-T
14734204-C-G
16955496-G-A
17358840-T-G
19370677-T-G
19447144-G-A
22862051-T-C
22947711-A-G
2681699-C-G
2683870-G-T
2882366-T-A
6370860-TG-T
7013094-G-A
7428985-T-C
7708639-C-T
8069365-CG-C
13299296-C-G
14043360-T-G
14667370-T-C
14940653-G-T
14940654-C-T
L554
15348727-A-G
16600799-C-A
17369836-C-G
17458600-G-A
19151757-C-G
21880592-T-C
22314868-G-A
22469151-T-C
22863212-C-T
22891922-C-T
23252166-T-C
K439
24008126-T-C
2753966-G-A
7829809-A-G
8595406-G-T
9163991-G-A
9381682-A-G
9627500-C-T
13991300-C-A
14005616-A-T
14106333-C-T
14170588-G-T
14491392-A-T
14984858-G-C
15069983-C-G
16439560-G-A
16631745-C-T
16940159-ATATG-A
17198440-T-C
17623341-C-T
17792147-C-A
18005603-G-A
18210023-G-A
18268451-T-G
18689073-CAAAATCAATCTATCTTATT-C
19207937-G-T
19263657-C-A
21434782-T-C
21602948-A-T
21812203-T-A
21962485-A-T
22461406-G-C
23256137-CA-C
23270266-C-T
23823210-C-G
22287561-C-T
FGC17436?
7533311-C-T
14040462-T-G
7077312-G-A
7340780-C-T
7445411-A-G
7543449-G-A
7671330-A-G
7921609-T-A
7922218-T-G
8578141-T-A
8623329-C-T
8633221-C-T
8821828-C-A
8841117-G-T
9007226-A-T
9111931-T-A
9398551-T-C
9855608-T-C
14209428-G-A
14277455-T-C
14461699-G-A
15343113-A-T
15495498-T-C
16840179-A-G
16990810-T-C
17748823-G-A
17939925-C-T
18234021-G-A
19256428-T-C
21189162-A-G
22147095-C-G
22159826-G-A
22293943-A-C
22447814-T-C
22475007-G-T
23126877-G-A
23207649-G-A
24365563-A-G
24436066-A-G
26722335-A-G
2892023-A-G
6364832-T-C
6865196-C-T
7677905-C-T
8207061-C-G
8662534-C-A
8707101-G-C
8992386-A-G
M2774
13673418-C-G
13683861-T-A
13853971-T-A
14289019-TA-T
15304000-T-G
15304001-A-AAG
15383158-T-C
15642341-C-A
15725021-A-G
FGC11677
16076215-G-A
16587000-C-A
17346050-T-C
17750495-C-T
18195736-A-C
19347457-G-A
19510916-A-C
21394679-G-T
21652590-C-T
21798383-T-C
22212613-G-C
22440447-G-A
22585878-G-T
22925941-GA-G
22929318-A-G
23293014-G-A
23576899-A-G
23631239-C-T
23811004-A-G
FGC17436
6991271-C-T
7077970-A-G
7793365-G-C
8326514-G-A
8375778-T-C
8416720-C-T
8483207-G-A
8634702-A-G
8645356-G-A
9068459-G-A
9988671-A-G
14030633-AT-A
14839912-A-G
15257618-T-C
15642522-A-C
15782429-T-A
17805315-G-T
17908960-A-C
18047799-C-T
18180714-C-A
18787497-T-C
19115401-G-A
19551318-A-T
21326267-A-G
21646628-C-A
22445767-A-C
22473516-G-A
22707161-A-G
23237100-G-A
23283791-G-A
24298392-T-C
Z17693
2663463-G-A
7693317-C-G
8021828-C-T
8502516-C-T
8844962-G-A
9039043-T-C
9848396-G-A
13973488-G-T
15561177-TC-T
16389030-G-A
16478950-T-G
16791195-A-T
16851240-T-C
17467209-T-C
18872866-T-C
18953582-T-C
19024610-T-C
19078127-G-C
19413456-A-C
19439379-G-T
19524190-G-A
21231656-T-C
21569331-G-T
22031459-T-C
22133337-AAAAT-A
22270174-G-A
22272110-G-C
22470001-G-C
22792165-G-T
23371577-G-T
S7898
S7897
FGC17443 A495
FGC17447 A496
FGC17445 A497
Z18131
FGC17444 A498
A499
FGC17438 A500
FGC17440 A501
FGC17446
A502
FGC17454 A503
FGC17441 A504
FGC17439 A505
FGC17437 A506
FGC17442 A507
S15280
FGC17450
FGC17456
FGC17449
16342413-A-G
FGC17451
FGC17452
FGC17453
FGC17455
21189431-G-A
21724671-CT-C
22977539-A-C
FGC17457
FGC17434
8388472-T-C
8674403-C-A
9074398-AC-A
17748370-T-C
19070696-G-A
21110671-TC-T
21403573-C-T
S7879
22187080-T-TA
23121664-G-T
Z18132
Z18133
15412479-G-GT
7696498-C-T
9133317-G-A
9402374-T-G
14876358-A-G
14945262-A-G
15744462-C-T
16377972-C-T
18716247-C-T
21034428-T-G
21727345-A-T
22447793-G-C
22464549-G-T
22469100-A-G
BY157
21182744-AC-A
15412479-G-GT?
7123938-A-G
17532507-CAG-C
17695361-G-A
19198286-T-A
21326515-C-G
21686735-G-A
22539324-C-T
24419776-C-T
26544622-T-G
3092221-G-A
8466577-A-T
8466578-C-T
8466579-T-C
8765754-G-A
14173297-T-C
14865873-TC-T
16180013-ACCT-A
16548507-G-A
19094604-G-A
19264950-C-T
21902775-CAGA-C
22474132-G-T
22699870-G-A
23196936-TA-T
23272788-G-A
23802828-T-C
28689044-C-A
6653849-A-T
6860694-A-T
6909829-G-A
7708054-T-A
7849769-G-T
8422355-C-T
8452179-T-C
13665201-A-G
14104635-G-A
15207582-G-A
15721901-A-T
16230319-C-G
17094451-T-C
17186868-A-T
17880590-C-T
17985252-C-T
18642290-G-A
21172465-C-G
21330280-G-A
21605660-T-G
21657748-T-G
21918934-A-G
22175017-G-C
22465351-A-T
22478967-C-T
22651643-A-G
23881133-G-A
23898725-T-C
24370917-C-G
24470190-C-G
S219 Z255
Z16417
FGC8077
Z16418
Z16419
Z16420
Z16421
Z16422
Z16423
Z16424
Z16425
Z16426
Z16427
Z16428
CTS12583 S3802
L159 S169
Z16429
22302027-T-G
22302029-C-A
22302033-A-T
ZZ7
Z16430
Z16431
Z16432
18030249-A-G
18554096-T-C
21504087-A-G
8401802-C-T
7534134-T-G
15933997-G-GA
16689175-C-G
21610818-C-T
21675273-A-G
21731809-T-C
22483610-C-A
8899679-G-T
14298240-T-A
14697913-G-T
CTS10015
CTS10016
CTS10017
21050843-T-TATCC
21355631-T-C
24472064-A-G
Z16950
Z17885
22459435-C-T
Z17885?
8037765-A-C
15139277-A-G
17985524-G-A
19391975-C-T
A479
15849753-T-C
17413807-T-A
19364869-G-C
24460509-T-G
6136859-G-A
7980754-T-C
9073602-A-G
18678383-G-T
21509742-G-GT
21856304-G-A
23633288-A-G
6895048-C-T
15513892-A-G
22573612-A-G
23133812-G-A
28547915-C-T
14173243-G-C
14201511-C-T
17694125-T-C
Z17885?
16297511-T-C
16992583-A-G
19469799-G-A
22242231-TTC-T
Z6686 FGC571
16928701-G-A
17534086-G-T
21295586-A-G
22566567-G-C
L159? S169?
7227888-C-G
8686080-G-A
14152029-A-G
15341821-C-A
15372289-T-G
15810957-T-TGG
16036834-T-C
16237346-G-T
17172200-TG-T
24437569-C-T
8197283-G-C
8435034-CCAGTAGGTTTTCACAGG-C
9468170-T-G
9776690-C-G
14096941-T-C
14482099-G-T
18726864-C-A
18726865-T-G
19055240-C-A
22560541-T-C
23831978-T-G
3012333-T-C
7545273-C-G
7598981-C-T
9985496-G-A
14644801-G-C
15306803-T-A
17761060-C-T
18034528-G-C
21395959-C-T
21531687-T-C
21825521-CT-C
22680935-G-C
7960879-G-A
8853004-G-A
14887545-G-C
17744857-C-T
18259675-C-G
22917056-G-A
23151253-A-T
23765375-A-C
CTS69
6754339-T-C
7129134-A-T
7667126-T-A
9148780-C-G
14245448-A-T
14867888-TG-T
15896223-C-T
15979720-G-A
16638246-C-T
17949811-C-T
18871705-G-T
21163974-C-T
AF13
22956737-G-A
22992150-T-C
23816407-A-C
6736199-T-C
7356913-C-T
7828077-C-G
8503377-A-G
13716891-G-A
14172761-A-G
15667799-C-T
15707878-C-T
15952637-C-T
16892434-G-A
19292368-A-C
PF5211
23989346-A-G
28790006-C-A
ZZ8
22436297-T-A
7465132-T-C
8542977-G-A
16338198-C-T
16750904-G-A
16991504-A-G
17924016-A-C
18218290-A-C
CTS848
CTS849
7865158-C-A
14959017-G-A
18180364-G-C
18657552-A-G
23062994-G-A
23233226-G-A
23775486-G-T
6898049-T-C
6898050-G-T
17380189-G-A
17536795-C-G
8470726-C-T
8642792-C-T
16805770-G-A
22473586-T-A
2806016-G-A
8643753-G-T
13681867-A-T
15007062-G-A
15586901-A-G
16339496-C-T
18939363-A-G
20813678-C-T
21674565-A-C
23306757-G-C
23464463-A-T
Z16433
A817
A817?
13289743-C-T
15153250-G-A
16271565-C-T
17536466-G-A
18078272-G-A
19068222-T-C
22485629-G-T
22595675-G-A
FGC8075
23490194-A-G
24887465-C-A
7665069-C-A
7666486-G-A
9049504-C-T
17031298-GAA-G
7597031-G-A
A430
8777440-A-G
14061027-A-G
14188584-A-G
14916578-T-C
15198079-T-C
19523766-C-T
21256493-G-A
21903575-G-A
22086381-T-C
A817?
A476
17585148-C-A
18225503-C-T
18385363-A-T
19219311-C-A
22458126-A-T
22471449-G-C
CTS11451
24484276-ATTTAAT-A
2807042-A-T
7597141-G-T
21596498-C-A
21667436-C-A
21911662-G-A
8084572-A-C
8820298-A-G
15350206-T-C
15663612-T-C
22486483-G-A
23159374-G-T
Z16434
Z18134
Z18135
ZZ9
Z17694
Z17695
Z18136
Z18137
Z18138
6708218-CTG-C
13832031-G-A
15422362-GA-G
15772713-C-T
16587152-G-A
PF3759
22892907-T-C
22948096-C-T
23151160-C-T
6784975-A-T
7472925-A-G
7617945-T-C
7646930-T-A
8429609-T-C
15331128-A-G
17498668-G-A
18681666-A-G
19048701-G-A
19534043-C-G
22423683-C-T
22805999-G-A
28801248-G-A
L159? S169?
Z18136?
M3453
7072953-T-C
7213548-C-T
7244306-A-C
7336797-A-C
7943433-G-T
8281985-G-T
8312556-A-G
M5421
14325711-G-A
17288910-CCTT-C
CTS9872
21118121-T-C
21151077-A-G
21665055-G-C
22294422-A-G
23139296-A-C
FGC19872
FGC19873
FGC19874
FGC19875
FGC19876
18207147-CT-C
20629200-C-T
22469479-T-A
FGC19877
A479
FGC19878
7553484-T-C
8641358-A-G
9811041-T-C
13232109-A-T
14333927-T-A
16848774-A-C
7273602-CA-C
8162708-G-A
10007097-C-A
14626541-A-G
14769451-C-G
17593722-C-A
18992293-A-C
19344036-A-G
22467434-G-T
22920963-G-A
23505250-AG-A
6863546-G-T
8289269-G-A
9007942-C-G
9386627-G-A
9650546-C-T
9898962-G-A
14138199-G-T
14919764-C-T
16737391-C-T
17094808-C-T
19080521-A-T
21091702-GA-G
21224338-G-A
21874375-A-G
22423576-C-T
7366212-C-G
9165984-C-T
13720369-G-C
15250069-T-G
15810951-G-A
15872579-C-G
17576924-A-G
21611725-G-T
22261374-G-C
22529103-G-C
23040384-A-G
23146794-G-A
Z16437
Z16439
Z16438
A660
CTS1243
8349944-G-A
8694467-T-A
14287916-G-A
F2261
18146142-A-G
18606094-A-C
18606400-C-T
21156440-A-C
21434366-C-T
21594060-C-A
Z16435
Z16436
Z16440
Z16441
Z16442
Z16443
Z16444
Z16445
2748596-G-C
6650241-C-T
7318065-G-A
13670874-A-G
18590206-G-A
21309568-T-C
22484527-T-A
22608740-C-A
9149548-A-AAA
15046694-A-G
16917063-G-A
17554376-T-C
A557
A558
8048110-A-G
8415893-G-T
16545301-C-A
16968749-G-T
19542938-T-C
21400363-G-T
21504248-T-C
21938049-C-G
22138000-A-G
7109717-A-C
8468136-T-C
8546926-G-C
8890393-G-A
9172337-C-T
9387058-G-T
21562790-CA-C
22042869-C-T
23157362-G-A
26707300-A-AT

The data for this diagram comes from this Excel file. It has both the data in it, as well as the VBA code that generates this webpage.

Comments, questions, and even criticism are always welcome.

Contact me at Alex@LittleScottishCluster.com.